ID: 1108078772

View in Genome Browser
Species Human (GRCh38)
Location 13:46710722-46710744
Sequence CCTGTTCCTATTCATTGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108078772_1108078774 1 Left 1108078772 13:46710722-46710744 CCTCAACAATGAATAGGAACAGG 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1108078774 13:46710746-46710768 ATCTTAAATGTACAATAATTTGG 0: 1
1: 0
2: 2
3: 50
4: 465
1108078772_1108078776 16 Left 1108078772 13:46710722-46710744 CCTCAACAATGAATAGGAACAGG 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1108078776 13:46710761-46710783 TAATTTGGTGGCATATATGAAGG 0: 1
1: 0
2: 1
3: 9
4: 181
1108078772_1108078775 4 Left 1108078772 13:46710722-46710744 CCTCAACAATGAATAGGAACAGG 0: 1
1: 0
2: 0
3: 9
4: 152
Right 1108078775 13:46710749-46710771 TTAAATGTACAATAATTTGGTGG 0: 1
1: 0
2: 2
3: 43
4: 840

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108078772 Original CRISPR CCTGTTCCTATTCATTGTTG AGG (reversed) Intronic
905246448 1:36617859-36617881 CCAATTCCTATTCATTCTTCAGG - Intergenic
905388099 1:37618210-37618232 CATTCTCCTATTCATAGTTGGGG - Intronic
905830151 1:41059246-41059268 CCTGTTCCCATTTAGTGCTGTGG - Intronic
908854957 1:68416507-68416529 CCTCTTACTATTCATCGTTATGG + Intergenic
909285990 1:73818301-73818323 CCTTTTCCAATTCATTTTTCAGG - Intergenic
914396458 1:147273930-147273952 TATGTTCCTATTCATGGATGTGG + Intronic
914904610 1:151733583-151733605 CCTGTTCCTGGTCTCTGTTGAGG - Intergenic
914963843 1:152234478-152234500 CATTGACCTATTCATTGTTGAGG + Intergenic
915730530 1:158050632-158050654 CCAGTTCCCATTCATGGTTAAGG - Intronic
915810780 1:158907831-158907853 CATGTTCCTTTTTATTTTTGTGG - Intergenic
920603368 1:207352798-207352820 ACTGTTCTTATTCTTTGGTGTGG - Intronic
920789343 1:209073923-209073945 CCTGTTCCTAGTCAATGCAGTGG - Intergenic
921148417 1:212380600-212380622 CCTGTCTCTATGCATTGTTTGGG - Intronic
922625349 1:227035490-227035512 GCTGTTCCTATTCCTTTCTGAGG + Exonic
923466801 1:234255382-234255404 ACTCTTCTTATTCATTGCTGGGG + Intronic
923516962 1:234706217-234706239 CCTATTTCTACTCACTGTTGAGG - Intergenic
924032800 1:239903841-239903863 CTTCTTCATGTTCATTGTTGTGG + Intronic
924058955 1:240152138-240152160 CCTTTTCTTATTCCTTCTTGAGG + Intronic
1066331730 10:34430921-34430943 CATGTTCCTCTTCATTTCTGTGG - Intronic
1073591062 10:104758102-104758124 CCAAGTCCTATTCATTGCTGGGG - Intronic
1074159634 10:110826895-110826917 TCTGTTTCTTTTTATTGTTGAGG + Intronic
1074381632 10:112985526-112985548 CCTGTCTTTTTTCATTGTTGAGG + Intronic
1074671961 10:115801111-115801133 TCTGTTCCTTTTCTTTGGTGAGG + Intronic
1076266452 10:129113029-129113051 CCTGTTCCTGTTCCTTGCTTGGG - Intergenic
1078621336 11:12911400-12911422 CCTGTTGCTATTCATGGAAGAGG + Intronic
1083138180 11:60699721-60699743 CCTATTCCTTTTCTTTGCTGTGG - Exonic
1086176358 11:83895677-83895699 CCTGCTGCTATTCATTCTTCAGG + Intronic
1095047996 12:37532162-37532184 CATGTTCTTTTTCATTGTGGAGG + Intergenic
1096236516 12:49931782-49931804 CCTGTTCCAATTCATGGTCCTGG - Intergenic
1097765580 12:63523084-63523106 GCTGTTCTTTTTCATTGTTGTGG - Intergenic
1097807254 12:63979579-63979601 CCTGTTGCACTTCATTGTTATGG + Intronic
1099633218 12:85177060-85177082 CTTGTTCCAATTAATTGATGAGG - Intronic
1099670194 12:85681443-85681465 CCTGTTCCTCTTCCTTTTTGGGG + Intergenic
1102424207 12:112828040-112828062 GCTCTTCCCATTCACTGTTGAGG - Intronic
1104266677 12:127239984-127240006 CCTCTTCCGATCCAGTGTTGTGG - Intergenic
1104863741 12:131940381-131940403 TCTGTTCCTTCTCATTGCTGCGG + Intronic
1104865781 12:131952750-131952772 CCTGTTTCTTTTTATTGTTGAGG + Intronic
1106076439 13:26465017-26465039 CATGTTCCAATTCCCTGTTGTGG - Intergenic
1108078772 13:46710722-46710744 CCTGTTCCTATTCATTGTTGAGG - Intronic
1108616852 13:52141666-52141688 CCTGTTCCATTTCATTATTCTGG + Intronic
1108930300 13:55809194-55809216 CCTGGTTCTCTTCATTTTTGTGG - Intergenic
1110662643 13:78075410-78075432 CCTTTTCCTATTGCTTGTTTTGG - Intergenic
1114929820 14:27452782-27452804 ACTGTACCTCTTCATTTTTGGGG - Intergenic
1115062396 14:29208892-29208914 CCTCTTCTTGGTCATTGTTGGGG + Intergenic
1117124412 14:52606172-52606194 CCTGTGCTTTTTCTTTGTTGGGG + Intronic
1117994821 14:61468560-61468582 CTTATTCCTATTCATTTTTGTGG - Intronic
1119744562 14:77034697-77034719 CCTGTTGCTATACCTTTTTGAGG + Intergenic
1120326246 14:83031837-83031859 GATGTTCCTATTAATTGGTGTGG - Intergenic
1121123390 14:91390568-91390590 ACTGTTCCAAGTCAGTGTTGTGG + Intronic
1124622650 15:31284061-31284083 CCTGTACCTCTTCCTTGGTGAGG + Intergenic
1124913653 15:33947363-33947385 ACTTTTCCTATTCATTGGTTGGG - Intronic
1127915836 15:63454085-63454107 CATGTTGCTATTAATTTTTGTGG + Intergenic
1128738245 15:70065814-70065836 CCTTTTCCTACTCCTTGGTGTGG - Intronic
1133515574 16:6505832-6505854 CCAGGTCCTACTCAGTGTTGGGG + Intronic
1134864157 16:17590023-17590045 GCTGACCCCATTCATTGTTGAGG + Intergenic
1135285772 16:21191714-21191736 CCTTTTCCTATTGATTTTTAGGG - Intergenic
1137043501 16:35636480-35636502 CATGTACATATTCATTTTTGAGG - Intergenic
1145411267 17:22668337-22668359 CATGTTCTTTTTCATTGTGGAGG + Intergenic
1146244961 17:31272332-31272354 AGTGTTCATATTCATAGTTGTGG + Intronic
1146659552 17:34655532-34655554 CCTGTTCCAATGCATGGTTCTGG + Intergenic
1147169345 17:38609048-38609070 CCTGTTCCTATTGCATCTTGGGG - Intergenic
1147531010 17:41277363-41277385 CCATTTCCTTTTTATTGTTGTGG - Intergenic
1148900980 17:50876977-50876999 CCTGGAAGTATTCATTGTTGAGG + Intergenic
1150750368 17:67856433-67856455 CTTTTTCCTATTCTTTGTTTTGG + Intronic
1151698091 17:75728209-75728231 TCTGTTCCTATTTATGGATGAGG - Intronic
1153322305 18:3785315-3785337 CCTGTTCCTTTGCTTTGTAGGGG + Intronic
1155742189 18:29302196-29302218 CCTTTTCCTATTCATCTTTTAGG + Intergenic
1156951868 18:42910449-42910471 CCTGTTCCCATTTAGGGTTGTGG - Intronic
1157021657 18:43790189-43790211 CTTGTACCTATTCATAGTTTTGG + Intergenic
1157326380 18:46671843-46671865 CCTGTTCTTTTTCCTGGTTGGGG - Intronic
1158013189 18:52752416-52752438 CTTCTTCTTATTCATTTTTGGGG + Intronic
1160565726 18:79785684-79785706 CCTGTTTATGTTCATTGTTTGGG - Intergenic
1162766609 19:12923778-12923800 CCTGTTTTTATTCTTTGTAGAGG + Intronic
1163449850 19:17370129-17370151 CCTGTTACTGTTCATTTTGGGGG - Intronic
1164718575 19:30414120-30414142 CCTGTACCTATTTAATGTTTTGG + Intronic
1165399237 19:35587035-35587057 CCTCTTCCCATTCACTGTTCTGG - Intergenic
927483516 2:23472956-23472978 ACTGTGCCTATTCATCTTTGTGG - Intronic
928057130 2:28068184-28068206 TCTGTTCCTATTCTTTATTACGG - Intronic
928649094 2:33386247-33386269 CCTGTTCCTATGCAATGTTTAGG - Intronic
929001678 2:37353236-37353258 CCTGTTGCTGTTCATTGTTTAGG - Intronic
933144816 2:78838991-78839013 TGTGTTGCTGTTCATTGTTGAGG + Intergenic
936963202 2:118098645-118098667 CCTGTTACTCTTCATAGTGGAGG - Intronic
938205755 2:129421523-129421545 CCTTTTCTTATCCATTTTTGTGG - Intergenic
939342175 2:140912070-140912092 CCTCTTCCTATTGATTTTTTAGG + Intronic
943919863 2:193692058-193692080 CCAGTTCTTACTCATTGCTGTGG - Intergenic
944372605 2:199002813-199002835 CCTTTTTCTATTGTTTGTTGTGG - Intergenic
945991295 2:216397530-216397552 CCTGTTCCCTGTCCTTGTTGAGG - Intergenic
948374702 2:237513682-237513704 CCTCTTCATGTTCATTGTGGGGG + Intronic
1174685307 20:52448781-52448803 CCAGTTCCTAAACATTGTGGTGG - Intergenic
1177610115 21:23435384-23435406 CTTGTCCCACTTCATTGTTGGGG + Intergenic
1178709463 21:34902002-34902024 ACATTTCCTATTCATTGTGGTGG - Intronic
1181025607 22:20125716-20125738 CCGGTTCCCATTAGTTGTTGCGG + Intronic
1181290602 22:21789964-21789986 TCTTTTCCTATTCATTTTTCAGG + Intronic
1183579547 22:38715780-38715802 CCTGTTCCTCTGCAGTGCTGGGG + Intronic
950053282 3:10007918-10007940 CCTGGTCCTGTTCTTTATTGGGG - Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
951790678 3:26480483-26480505 CCTCTTCCTTTTCATTTTGGTGG + Intergenic
953536677 3:43782342-43782364 CCTGTTCTCAGTCACTGTTGAGG + Intergenic
956949121 3:74259476-74259498 TTTGTTCCTAGTCATTGATGTGG - Intergenic
957046477 3:75378902-75378924 CCTTTTCCTATTCTGTGTTCTGG + Intergenic
957347955 3:78985929-78985951 CCTCCTTCTTTTCATTGTTGGGG - Intronic
957531648 3:81447898-81447920 CCTTTTCCTATACATTCCTGAGG + Intergenic
958015481 3:87935236-87935258 CCTTTTTCTCTTCATTTTTGGGG - Intergenic
962679297 3:137781999-137782021 CCTTTTCTCATTCATTGTTCTGG - Intergenic
964151434 3:153530240-153530262 CCTGTTCCTATCTATAGTTAAGG - Intergenic
964288663 3:155150760-155150782 CCTGTTCATATTCAATTTTATGG + Intronic
966747568 3:183292440-183292462 TCTGTTAGTATTTATTGTTGGGG - Intronic
968110525 3:196042729-196042751 ACTGTTCCGAGTCATTATTGTGG - Intronic
972383877 4:38544783-38544805 ATTGTTCCTATTCATTTTTCAGG + Intergenic
977020594 4:91754381-91754403 CTTCTTGATATTCATTGTTGTGG + Intergenic
980026690 4:127776490-127776512 TCTTTCCCTATTCACTGTTGGGG - Intergenic
980031872 4:127841333-127841355 CCTGTTCCTACTGATTAATGAGG + Intergenic
983039107 4:162903221-162903243 CCTTTTCTTTGTCATTGTTGGGG + Intergenic
986284999 5:6352796-6352818 CTTGTTCATCTTCATTGTTGCGG - Intergenic
986552866 5:8978397-8978419 CCTGTTGCTTTTCCTTTTTGCGG + Intergenic
987308241 5:16658523-16658545 CCTGTTCCCATTCATTTTCTTGG + Intergenic
987779651 5:22417895-22417917 TCTGTTGCTATTCATGGTTTTGG + Intronic
988559744 5:32269776-32269798 GCTGTTCTGATCCATTGTTGAGG + Intronic
989126828 5:38062327-38062349 CCTCTTCTTATTCATGGTAGAGG + Intergenic
990018249 5:51093195-51093217 TCTGTTCCTATTCATTCTTCAGG - Intergenic
990023844 5:51160941-51160963 CTTGTTCCTTTTCATCTTTGTGG - Intergenic
992712689 5:79476283-79476305 TCTGTTTGTGTTCATTGTTGTGG - Intronic
996820710 5:127623811-127623833 CCTATTTCCATTCATTGTCGAGG - Intergenic
998470359 5:142378938-142378960 CTTGTTCCCATTCATTATTTTGG + Intergenic
1001742419 5:174064990-174065012 TCTGTTTCTATTCAGGGTTGGGG - Intronic
1003288871 6:4760934-4760956 CCTTGTCCTATTCCTTGTAGTGG + Intronic
1008043050 6:46822366-46822388 CCCTATCCTATTCACTGTTGGGG + Intronic
1008391791 6:50960400-50960422 ACTATTCCTATTCCTTGTTGTGG - Intergenic
1009827991 6:68892233-68892255 CCAGTGGCTTTTCATTGTTGAGG + Intronic
1010733306 6:79413278-79413300 CCTGTTCTTATTCAGGGCTGCGG + Intergenic
1012767717 6:103389068-103389090 CCTCTTCATATTCATCTTTGTGG + Intergenic
1014117371 6:117680718-117680740 CATGTTCCTTTTCATGATTGAGG + Intronic
1016015411 6:139179450-139179472 CCTCATCCTATTTATTGTTCAGG - Exonic
1016484513 6:144521903-144521925 CTTGTTATTATTCATTGTGGGGG + Intronic
1022138926 7:27475525-27475547 CCTGATCCTTTGCCTTGTTGGGG - Intergenic
1022774922 7:33516880-33516902 CAAATTCTTATTCATTGTTGTGG - Intronic
1024211129 7:47206116-47206138 CATTTTACTATTCATTTTTGAGG + Intergenic
1031692432 7:124805496-124805518 CCAATTCTTATTCATTGTTTAGG - Intergenic
1032924770 7:136590723-136590745 CCTATTCCAATATATTGTTGAGG - Intergenic
1033771893 7:144561675-144561697 CCTGTTCTTTTTCATCATTGTGG - Intronic
1036479837 8:9129972-9129994 TTTGTTCCTTTTCATTGCTGAGG - Intergenic
1037115979 8:15227768-15227790 TCTGTGCCTATTCAGAGTTGTGG - Intronic
1038788322 8:30642874-30642896 CCTCTTTCTATTTATTTTTGAGG + Intronic
1039136388 8:34328004-34328026 CCTCTGCCTATTCATTCCTGCGG + Intergenic
1041807162 8:61864674-61864696 GCTGTATCTCTTCATTGTTGTGG + Intergenic
1043951383 8:86312970-86312992 TCTGTTCCTGTTCATAGTTCTGG - Intronic
1046349643 8:112990550-112990572 GCATTTCCTATTCATTGTTCTGG - Intronic
1046759382 8:118005397-118005419 GCTGTTTTTAATCATTGTTGAGG - Intronic
1048642911 8:136384433-136384455 CCTTTTTCTTTTCATTTTTGGGG - Intergenic
1051913047 9:22176996-22177018 CATGTTCCTCATCATAGTTGGGG - Intergenic
1052705835 9:31992450-31992472 TCTGTTCTTTTACATTGTTGAGG - Intergenic
1053345959 9:37378451-37378473 CCTCTGCCTATTCATTGTCTAGG - Intergenic
1059637075 9:116181605-116181627 CATTTTCCTTTTCATTGTGGTGG - Intronic
1062653585 9:137590606-137590628 CCTCCTCCTATTGGTTGTTGCGG - Intergenic
1186827874 X:13360138-13360160 CCTGTTCCTATCCTTTGTCCAGG + Intergenic
1187228297 X:17395387-17395409 CATGTTCCTATTTATTTTGGGGG - Intronic
1187692880 X:21889053-21889075 CTTATTCCTTTTCATTGTTCAGG + Intergenic
1188346360 X:29071295-29071317 CCTTTTCCTGTTCATCCTTGTGG - Intronic
1190008760 X:46764348-46764370 CCTGATCATATTCACTGATGCGG + Intergenic
1195913312 X:109911486-109911508 CCCCTTCCTATTCATCCTTGAGG - Intergenic
1196396714 X:115271494-115271516 ACTGTTCCTATTCATTGCATGGG + Intergenic
1196775085 X:119331313-119331335 CATTTTCCTATTCAGTTTTGGGG + Intergenic