ID: 1108080697

View in Genome Browser
Species Human (GRCh38)
Location 13:46731887-46731909
Sequence CTGTCCTAAGGCGTTGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 4, 3: 4, 4: 79}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108080697 Original CRISPR CTGTCCTAAGGCGTTGAGAA TGG (reversed) Intronic
913564905 1:120063374-120063396 CTGTCCTCAGCCGTTGCAAATGG - Intronic
914285491 1:146222724-146222746 CTGTCCTCAGCCGTTGCAAATGG - Intronic
914546522 1:148673479-148673501 CTGTCCTCAGCCGTTGCAAATGG - Intronic
914620043 1:149397191-149397213 CTGTCCTCAGCCGTTGCAAATGG + Intergenic
923019354 1:230150956-230150978 TCGTCCTGAGGAGTTGAGAATGG - Intronic
923971297 1:239205861-239205883 ATGCCCTAGGGCTTTGAGAAAGG + Intergenic
1067308227 10:45087053-45087075 CTGTCCTATTGCATTGAGTAGGG + Intergenic
1069289309 10:66757685-66757707 TTGTCCAAAAGCGTTCAGAAAGG + Intronic
1069594784 10:69663536-69663558 CTGCCCTAAGGAATAGAGAATGG + Intergenic
1069735839 10:70653570-70653592 CTGGACTAAGGAGGTGAGAAAGG - Intergenic
1070987827 10:80703312-80703334 CTGTCCAACGTCTTTGAGAATGG - Intergenic
1074472084 10:113736381-113736403 TTTTCCTAAGCGGTTGAGAATGG - Intergenic
1077981497 11:7305749-7305771 CTGTCCTGAGACGGTGATAATGG - Intronic
1079032332 11:16994834-16994856 CTGTGCAAATGCTTTGAGAAGGG - Intronic
1079665785 11:23103933-23103955 GAGTCCAAAGGTGTTGAGAATGG - Intergenic
1081197981 11:40184853-40184875 CTGTCCTAAGAGGTGGAAAATGG - Intronic
1081979628 11:47258192-47258214 ATGTCCTAAGGATCTGAGAAGGG + Exonic
1090383963 11:126345813-126345835 CTGTGGGAAGGCCTTGAGAATGG + Intergenic
1092758365 12:11786072-11786094 CTGTCCTAGGGATTTGAGGACGG + Intronic
1092792951 12:12085329-12085351 ATGTCCTCAGGAGATGAGAAAGG - Intronic
1094056437 12:26273812-26273834 CTGGCCTAAGGAGCTCAGAAAGG - Intronic
1098504374 12:71232264-71232286 CTGTACAAAGGCCTTGAGATGGG - Intronic
1103113001 12:118298520-118298542 CTGTCCTAATGTTATGAGAATGG + Intronic
1108080697 13:46731887-46731909 CTGTCCTAAGGCGTTGAGAATGG - Intronic
1110779594 13:79449555-79449577 CTCTCCCAAGGCCTTGGGAAAGG - Intergenic
1114683723 14:24507983-24508005 CTGTCCTAGGCTGTAGAGAATGG + Intronic
1115942241 14:38622363-38622385 CTCTGCTAAGGCAGTGAGAAAGG + Intergenic
1116049363 14:39784363-39784385 CTTTCCTAAAGCTTAGAGAATGG - Intergenic
1119068203 14:71552111-71552133 CTGTCCTAAAGCCTGGGGAAAGG - Intronic
1127128561 15:55837545-55837567 CTGTCCTAAAGTGAAGAGAATGG + Intronic
1131771527 15:95742952-95742974 CTGTGCTAAGGCACTGAGACAGG + Intergenic
1135493264 16:22928873-22928895 CTGTCCTAACGTCTTGGGAATGG - Intergenic
1140254646 16:73324599-73324621 CTGTCCTGGGGATTTGAGAATGG + Intergenic
1141037797 16:80643508-80643530 CTCTGCTAAGGCGTGCAGAAGGG - Intronic
1141735808 16:85851881-85851903 CTTTCCCAAGGCCTTTAGAAAGG + Intergenic
1141852846 16:86659123-86659145 CTGACCTATGGCTTTGAGATAGG - Intergenic
1142428207 16:90011819-90011841 CTGTTCTAAGGCTGTGAGCAGGG + Intronic
1158247943 18:55452741-55452763 TTGTCCTAAGCCCTTGAGCAAGG - Intronic
1165029204 19:32985200-32985222 CTGACCTCAGGTGATGAGAAGGG + Intronic
1168412577 19:56148900-56148922 CTCTCCTAGAGCCTTGAGAAGGG - Intronic
928495750 2:31829766-31829788 CTGTGCTGAGGAGTTGAGATGGG + Intergenic
929650529 2:43676319-43676341 CTGTCCTAACGCCTGGAAAATGG - Intronic
930931538 2:56889398-56889420 TTGTCCTAAGCAGTTGATAAAGG - Intergenic
937688891 2:124731447-124731469 TTGTGCTAAGGCGTTTAAAAAGG + Intronic
946007821 2:216540653-216540675 CTGTCCTAAGGCCTAGATCAAGG + Intronic
1172759160 20:37309833-37309855 GTGTCCTGAGGTGTTGAGAATGG - Intronic
1172873004 20:38147423-38147445 CTGTGCAAAGGCCCTGAGAAGGG - Intronic
1175844522 20:62051544-62051566 GTGTCCTATGGCGGTGAGAGGGG - Intronic
1181783301 22:25208185-25208207 CTGTCCTTAGGCCTTGAACAGGG - Intergenic
951083735 3:18485246-18485268 CTGTCAGAATGCATTGAGAAGGG - Intergenic
953783370 3:45891923-45891945 TTGTCCTAAAGAGTTGAGGAGGG - Intronic
954685851 3:52369765-52369787 CAGTCCTCAGGCCTGGAGAAAGG - Intronic
965218568 3:165896998-165897020 ATGTCCTAGGGTGTTTAGAAAGG + Intergenic
966905383 3:184520533-184520555 CAGTTCTAAGGTGTTGACAATGG + Intronic
976064369 4:81166984-81167006 CTGTGTTAAGGGGTGGAGAAAGG - Intronic
977954613 4:103012237-103012259 GTGTCCTAATGCTTTGTGAAAGG - Intronic
980663522 4:135898883-135898905 ATGTCCTAAGGCTTTGTGAAAGG + Intergenic
986311099 5:6551723-6551745 CTGGGCAAAGGCGTGGAGAAGGG - Intergenic
987985442 5:25140254-25140276 CTATCCTACAGCCTTGAGAACGG + Intergenic
989736289 5:44711141-44711163 CTGTCATAAGGAAATGAGAATGG + Intergenic
990179103 5:53140917-53140939 CTGTCCTAAGTGGTTGAAGAAGG + Intergenic
992168604 5:74079412-74079434 CTTACCTAAGGCATTTAGAAAGG + Intergenic
997990969 5:138543947-138543969 TTGGCCTGAGCCGTTGAGAATGG + Intergenic
998256875 5:140594725-140594747 CTGTCCTCAGGGCCTGAGAAAGG + Intergenic
999499558 5:152133034-152133056 CTGTCCTAGGGCCTTGTGGAAGG - Intergenic
1000746125 5:165036138-165036160 CTGTGCTAAAGCTTTGAAAAAGG - Intergenic
1003027194 6:2565396-2565418 GTGTTCTAAGGCTTGGAGAAAGG + Intergenic
1026944759 7:74308412-74308434 ATGTCCTAAGGAGGTGAGAATGG + Intronic
1031609984 7:123814453-123814475 TTTTCCTAAGGTGTTCAGAAAGG - Intergenic
1035875964 8:3189940-3189962 CTGTGCCAAGGCGTTGGGCACGG + Exonic
1037594337 8:20342320-20342342 CTGAGCTATGGCGTTGTGAAGGG + Intergenic
1038618093 8:29114494-29114516 CTGTCCTTAGGGGTGGTGAAGGG + Intronic
1038851753 8:31285490-31285512 CTGGCTTAAGGCATGGAGAATGG - Intergenic
1040894896 8:52355703-52355725 CTGACCTAAGGATTGGAGAATGG - Intronic
1043888246 8:85627437-85627459 CAGTCCTAAGGCTTGGGGAAAGG - Intergenic
1047531360 8:125679733-125679755 CTGTCCTAAGTCAATGGGAATGG - Intergenic
1048610168 8:136014000-136014022 CTATCCTCAGTCGTTGAGAATGG - Intergenic
1056331892 9:85528203-85528225 CTGTCCTGGGGCCTTGACAAGGG + Intergenic
1060817792 9:126644488-126644510 CTGTCCTAAGGCTGCGGGAAGGG - Intronic
1187871017 X:23765517-23765539 CTGTCCCAATGCTTTGAAAATGG - Intronic
1189751243 X:44225072-44225094 CTATCCTAAGGCTCTAAGAAAGG + Intronic
1190825677 X:54016023-54016045 GTGTCCTAAGGTCTTGAAAAAGG + Intronic
1194891664 X:99386153-99386175 CTGCCCTAAGTCTTTGAAAATGG + Intergenic
1195327312 X:103768323-103768345 CTGCTCTAAGGTGTTGTGAAAGG - Intergenic
1202168903 Y:22020211-22020233 CTGTCCTAAGGCGATTAGAAAGG - Intergenic
1202222458 Y:22566157-22566179 CTGTCCTAAGGCGATTAGAAAGG + Intergenic
1202320657 Y:23629503-23629525 CTGTCCTAAGGCGATTAGAAAGG - Intergenic
1202550110 Y:26040553-26040575 CTGTCCTAAGGCGATTAGAAAGG + Intergenic