ID: 1108080848

View in Genome Browser
Species Human (GRCh38)
Location 13:46733384-46733406
Sequence TTGGTGGGAAGGAGGTTAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 223}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108080836_1108080848 27 Left 1108080836 13:46733334-46733356 CCACCATTTTCAGTGCTGTTTAC 0: 1
1: 0
2: 0
3: 19
4: 207
Right 1108080848 13:46733384-46733406 TTGGTGGGAAGGAGGTTAATTGG 0: 1
1: 0
2: 0
3: 15
4: 223
1108080841_1108080848 -6 Left 1108080841 13:46733367-46733389 CCTCTATATCCCTGGCTTTGGTG 0: 1
1: 0
2: 1
3: 18
4: 205
Right 1108080848 13:46733384-46733406 TTGGTGGGAAGGAGGTTAATTGG 0: 1
1: 0
2: 0
3: 15
4: 223
1108080838_1108080848 5 Left 1108080838 13:46733356-46733378 CCATGATATTGCCTCTATATCCC 0: 1
1: 0
2: 0
3: 11
4: 153
Right 1108080848 13:46733384-46733406 TTGGTGGGAAGGAGGTTAATTGG 0: 1
1: 0
2: 0
3: 15
4: 223
1108080837_1108080848 24 Left 1108080837 13:46733337-46733359 CCATTTTCAGTGCTGTTTACCAT 0: 1
1: 0
2: 1
3: 34
4: 310
Right 1108080848 13:46733384-46733406 TTGGTGGGAAGGAGGTTAATTGG 0: 1
1: 0
2: 0
3: 15
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108080848 Original CRISPR TTGGTGGGAAGGAGGTTAAT TGG Intronic
902648941 1:17823877-17823899 TTGGTGGAAAGGGGGTTACCAGG + Intronic
903997675 1:27317918-27317940 ATGGTGGGGAGGAGATTAAGGGG - Intergenic
904549268 1:31301894-31301916 TTGGTGGGAGGGAGGAAAGTTGG + Intronic
905644711 1:39617183-39617205 GGGGTGGGAAGGAGGTCAGTGGG + Intergenic
908892993 1:68866321-68866343 TTGGTGGGAAGGACATGAAATGG + Intergenic
909887071 1:80955443-80955465 TTGCTGGTAAGGATGTTAAATGG + Intergenic
910353499 1:86327550-86327572 TTGTTGGGAAGGATGAGAATGGG - Intergenic
912567679 1:110599917-110599939 CTGGTGGGAGGAAGGTGAATTGG + Intronic
913360954 1:117979427-117979449 ATGGTGAGAAGGAAATTAATAGG - Intronic
913393024 1:118335264-118335286 TTGGAGAGAAAGAGGTTAAAGGG - Intergenic
913552493 1:119929249-119929271 TTGCTGGAAAGCAGGTTAAAAGG - Intronic
915492878 1:156261226-156261248 CTTGGGGTAAGGAGGTTAATGGG - Intronic
915605481 1:156947675-156947697 AGGGTGGGAAAGAGGTAAATAGG - Intronic
919104733 1:193134874-193134896 GTGGTGGGAACTAGGTGAATGGG + Intronic
920617402 1:207507053-207507075 TGGGTGGGAAGGAAGAAAATGGG + Intronic
920633736 1:207678538-207678560 TGGGTGGGAAGGAAGAAAATGGG + Intronic
922060154 1:222081575-222081597 GTGGTGGGAAACAGGTTAAAGGG - Intergenic
922903446 1:229156160-229156182 TTGGAGGGAGGGAGGCCAATGGG + Intergenic
922979146 1:229810443-229810465 TTGGTGGGCAGGGGGTTGAGAGG + Intergenic
1064462742 10:15550861-15550883 TTGGGGGGCAGGAGGGTGATAGG + Intronic
1064980648 10:21163127-21163149 CTGGAGAGAAGGAGGTTAAATGG + Intronic
1065236364 10:23656969-23656991 TTGTTGGGAAGAAGTTTAGTTGG + Intergenic
1067366740 10:45638159-45638181 TTGCTGGGAAGAATGTAAATTGG + Intronic
1068176270 10:53463550-53463572 TTGGTGGGGAGGAGGGTAGATGG - Intergenic
1069748509 10:70731346-70731368 TGAGTGGGAAGGAGGTTTCTGGG - Intronic
1069801102 10:71082165-71082187 TTGGTGGGGAGCAGATTGATAGG - Intergenic
1070128360 10:73639818-73639840 GTGGTGGGAAGGCGGGTGATGGG - Intronic
1070377940 10:75852411-75852433 TTTTTGGAAAAGAGGTTAATTGG + Intronic
1072103830 10:92255060-92255082 TTGGTGGGCAGTAGGGAAATTGG - Intronic
1077605452 11:3607653-3607675 ATGGTGGGATGGAGGTCAAAGGG + Intergenic
1077755769 11:5025811-5025833 TTGTTGGGAAGCAGGGTATTGGG - Intergenic
1080462619 11:32468841-32468863 TTGGTGGGGAGGAGGACAATGGG + Intergenic
1081611592 11:44566241-44566263 TTGGTGGGAAGCAGGTGAGGCGG - Intronic
1081994473 11:47354883-47354905 TTTTTTGGGAGGAGGTTAATGGG + Intronic
1085464371 11:76713826-76713848 TTGGTGGGTGGGTGGTGAATGGG + Intergenic
1086057050 11:82658974-82658996 TTGTTGGGGGGGAGGTAAATTGG + Intergenic
1086107166 11:83158053-83158075 TGGGTTGGAAGGAGGTGAAGGGG + Intronic
1086199408 11:84183400-84183422 TAGGTGGGGAGGAGGTGTATGGG + Intronic
1086453684 11:86941339-86941361 TTTGTGGGAAGGAGGGTAGAGGG + Intronic
1086779924 11:90891159-90891181 TTGGTGGGGTGGCGGTTATTTGG - Intergenic
1088498545 11:110458387-110458409 TTTGTGGGAAAGAGTATAATGGG + Intronic
1090523987 11:127509511-127509533 TTGGTGAGAAGCAGGTTAGCAGG - Intergenic
1093810322 12:23485042-23485064 TTGGGGGGATGGAGGTAAAGTGG - Intergenic
1094522633 12:31208991-31209013 TTTGTGGGAAGAGGGTTTATTGG - Intergenic
1100283756 12:93143984-93144006 TTTGTGGGAGGGAGGGAAATTGG + Intergenic
1100948425 12:99816118-99816140 TTGGTGGGAATGTGGTGAAAAGG - Intronic
1102525376 12:113508912-113508934 TTGGTGGGGAGGGGATTAAAGGG - Intergenic
1102992943 12:117327805-117327827 TTGGAGGGAAGGGGCTTAAAGGG + Intronic
1106029726 13:25989071-25989093 TTAGTGTTTAGGAGGTTAATCGG + Intronic
1108080848 13:46733384-46733406 TTGGTGGGAAGGAGGTTAATTGG + Intronic
1109200502 13:59425685-59425707 TTGTTGGGAAGGAAATTAATTGG - Intergenic
1112759517 13:102678066-102678088 TTGGTGGGAAGGAGGATCAATGG + Intronic
1113451070 13:110410140-110410162 TTGGTGTGAGGAAGGTTAAATGG - Intronic
1114730683 14:24989689-24989711 ATGCTGGGAAATAGGTTAATTGG - Intronic
1116787388 14:49302554-49302576 TTGGGGGTAAGGAGGTGAGTTGG + Intergenic
1117227656 14:53679743-53679765 TTGGTGCCAAGGAGGCTATTCGG + Intergenic
1117749687 14:58908144-58908166 TTGGTGTGAATGAGGAGAATAGG + Intergenic
1118454128 14:65929691-65929713 GTGGTGGGAAGGAGGCAAAAGGG + Intergenic
1121860438 14:97312756-97312778 TTGGTGGAAACGTGGATAATGGG + Intergenic
1122250886 14:100438976-100438998 TTTGTGGGCAGGTGGTCAATTGG - Intronic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1124082992 15:26518352-26518374 TAGGTGGGAAGGAGCTTCTTGGG - Intergenic
1124142439 15:27088921-27088943 TGGCTGGGAAGGAGGGGAATGGG + Intronic
1125198473 15:37076184-37076206 TTGCTGGGGAGGAGGGTAGTAGG - Intronic
1126687388 15:51260442-51260464 TAGCTTGGAAAGAGGTTAATTGG + Intronic
1128208139 15:65870365-65870387 GTGGTGGGAGGGAGGGTAAGAGG + Intronic
1130930990 15:88427856-88427878 TTGCTGGGAAGGAGCTTCTTGGG - Intergenic
1131687535 15:94786545-94786567 TTGTTGGGAAGAAGCTTAAAAGG - Intergenic
1133008581 16:2897855-2897877 TGGGTGGGAAGAAGGTGAGTTGG + Intronic
1133866033 16:9644168-9644190 TTGGTGGGAAGAAGCTGAAGGGG + Intergenic
1134537177 16:15035343-15035365 GTGGCTGGAAGGAGGTTATTGGG + Intronic
1134872903 16:17667763-17667785 TTTGTGGGGAGGAGGTTTATAGG + Intergenic
1135101552 16:19610697-19610719 TTGCTGGGAAGGAGGTTCCCAGG + Intronic
1135911817 16:26568085-26568107 TTGCAGGGAAGGACGTTCATTGG - Intergenic
1139130526 16:64137814-64137836 TTGGTGGTGAAGATGTTAATGGG + Intergenic
1139215599 16:65122447-65122469 TTTGGGGGAAGGAGGAAAATGGG - Intronic
1140689447 16:77467627-77467649 TTGGAGGGAAAGAGTTTAATAGG - Intergenic
1144630635 17:16870390-16870412 TTGCTGGGCAGGAGGCTGATTGG + Intergenic
1144650686 17:17005062-17005084 TTGCTGGGCAGGAGGCTGATTGG - Intergenic
1146200510 17:30853435-30853457 TTGGCGGGAAGGAGGAAGATGGG - Intronic
1147052052 17:37802656-37802678 TTTGAGGGAAAGAGGTTGATTGG - Intergenic
1148290875 17:46448033-46448055 TTGGTGGGGAGAACTTTAATAGG - Intergenic
1148313065 17:46665738-46665760 TTGGTGGGGAGAACTTTAATAGG - Intronic
1150680074 17:67277554-67277576 TTGGTTAAAAGGAGGGTAATGGG + Intergenic
1155400960 18:25438384-25438406 ATGTGGGGAAGAAGGTTAATTGG - Intergenic
1155505369 18:26527746-26527768 TTTGGGGGCAGGAGGTTTATGGG + Intronic
1156530383 18:37809280-37809302 TTTGTGGGAAGTAGGTAGATGGG - Intergenic
1156781058 18:40851369-40851391 TTCGGAGGAAGGAGGTAAATAGG - Intergenic
1158659603 18:59374248-59374270 TTCCTGGGAAGGAGCTGAATGGG + Intergenic
1159338912 18:67109234-67109256 TTGTTTGGCAGGAGGTTAAGAGG + Intergenic
1162023297 19:7878823-7878845 CTGCAGGGAAGGAGGGTAATGGG + Intergenic
1162366807 19:10254663-10254685 GTGGTGGGAAGGAGCTTCCTGGG + Intronic
1163382200 19:16976546-16976568 TTGGTGGGCAGGGGGTGCATGGG - Intronic
1165149624 19:33753351-33753373 ATGGTGGGTGGGAGGATAATAGG - Intronic
1166696765 19:44856317-44856339 GTGTTGGGGAGGAGGCTAATAGG - Intronic
925946001 2:8864579-8864601 TTGGCGGGAAGGAGGTAACAAGG - Intronic
926704203 2:15825362-15825384 CTGGTGGGAAGGAGATTTCTCGG + Intergenic
927385506 2:22528848-22528870 TTGGTGGGAAGGGGGTTGGGAGG + Intergenic
929400790 2:41579146-41579168 TTGCCTGGAAGGAAGTTAATTGG - Intergenic
931838022 2:66120066-66120088 TTGGTGGGGATGTGGATAATGGG - Intergenic
932812340 2:74835268-74835290 TTGGAGGGGCGGGGGTTAATGGG - Intronic
933094704 2:78163571-78163593 TTGGTTGGTAGGATATTAATTGG - Intergenic
933517748 2:83327554-83327576 TGGGTGGGAAGTAGAATAATAGG - Intergenic
934865254 2:97803770-97803792 TTTGTGGGTAGGAGGTGAAGAGG + Intronic
937688471 2:124724767-124724789 TTAGTGGGAGGGAGGGTCATGGG + Intronic
939379751 2:141419501-141419523 TTGGTAGGTAGTAGGCTAATAGG + Intronic
942829536 2:180223426-180223448 TTGGTGGGAAGTGAGTGAATTGG - Intergenic
942862519 2:180632689-180632711 GTGATGGGAGGGAGGTGAATAGG + Intergenic
944416582 2:199485247-199485269 ATGGAGGGAAGGAGCCTAATTGG - Intergenic
946174834 2:217916277-217916299 CTGGAGGGGAGGAGGTGAATGGG - Intronic
948485738 2:238279701-238279723 CTGGTGGGAAGGAGGTGGAAGGG - Intronic
1168753075 20:297568-297590 ATGCTGGGAAGGAGGTAAAATGG + Exonic
1170398718 20:15957141-15957163 TGGCTGGAAAGGAGGATAATGGG + Intronic
1171060336 20:21951215-21951237 GTGGTGGGAGGTTGGTTAATGGG - Intergenic
1172560559 20:35884325-35884347 TTGGTGTGAAGGAGGCTCATGGG + Intronic
1174899579 20:54484492-54484514 TTGGGGGGAAAGTGGTTAAAGGG - Intronic
1175034430 20:55986764-55986786 GTGGTGCAAAAGAGGTTAATTGG + Intergenic
1175491593 20:59384066-59384088 GTGATGGGGAGGAGGTGAATGGG + Intergenic
951497535 3:23347754-23347776 TTGGTGAGAGGGAGATTAAAAGG - Intronic
951742789 3:25942785-25942807 CTGGTGGGAGGGAGGTAAACTGG - Intergenic
951867672 3:27325691-27325713 TTCATGGGAAGGAGGTTGATAGG + Intronic
952458832 3:33502987-33503009 TTAGCAGGAAGGAGGTTATTGGG - Intronic
952530967 3:34261224-34261246 TTGGTGGAAAGGAGGCAAATTGG - Intergenic
953373615 3:42410382-42410404 ATGGTGGGCAGGAGGGTAACGGG - Intronic
954998135 3:54900762-54900784 TTTGTGGGAAGGAGTATAAATGG + Intronic
955032517 3:55234534-55234556 TTCGTGGGAAAGAGATTTATTGG - Intergenic
957125083 3:76148561-76148583 TTGGTGGGAAGGAGTCTGATTGG - Intronic
957761718 3:84567377-84567399 TTGCTGGAAAGGAGGTAAATTGG - Intergenic
958713541 3:97749283-97749305 ATGGTGAGAAGGGGGTTATTAGG + Intronic
960234521 3:115266353-115266375 TTGGTAGTAAGAAGGTCAATTGG + Intergenic
961230282 3:125300850-125300872 TTGGTGGCAAGCATGTTAAGAGG - Intronic
962738043 3:138343355-138343377 TTAATGGGAAGGAGATTGATTGG + Intergenic
964408414 3:156373959-156373981 CTGGAGGGAAGCAGGTTAAGAGG + Intronic
964411135 3:156398996-156399018 TTGGTGGGTAGGAGATTGATGGG - Intronic
965110957 3:164421623-164421645 TTTGGGGGATGGAGGGTAATGGG - Intergenic
966146023 3:176813211-176813233 GTCGGGGGAAGAAGGTTAATTGG - Intergenic
966337662 3:178887582-178887604 TTGGTGGGACGGATGGTATTTGG - Intergenic
967511703 3:190320985-190321007 ATGGTGGGAAGAAGGATAATAGG - Intronic
969059955 4:4426564-4426586 TGGGTGGGAAGGAGGCTGCTGGG - Intronic
970323878 4:14903086-14903108 GTGGTGGGAAGGTTTTTAATGGG + Intergenic
972170614 4:36341283-36341305 TTGGTGAGGAGGAGATTAAGGGG + Intronic
973637442 4:52873300-52873322 GTAGTGGGAAGGTGGTTGATTGG - Exonic
973691109 4:53433274-53433296 TAGGAGGGAAGGAGTTTAGTGGG - Intronic
973779607 4:54276214-54276236 TTGGTGGGTAGGGGGTGAAAAGG - Intronic
974170548 4:58261093-58261115 TTGGTAGGAATGTTGTTAATGGG + Intergenic
977370012 4:96123880-96123902 AGGGTGGGAAGGAGGAAAATGGG + Intergenic
978632904 4:110767504-110767526 TTGGTGGGAAGGTGGAGAAATGG + Intergenic
980493123 4:133555407-133555429 TTGGTGTGGAGGAGGATGATTGG - Intergenic
981347811 4:143697107-143697129 TTGGTGGGTAGGATGATTATAGG + Exonic
981970011 4:150655999-150656021 TTTGTGGGGAGGAGGTTAGAGGG + Intronic
982087191 4:151847729-151847751 TTGGTGGGGAGGCGGGGAATGGG + Intergenic
987029927 5:13966498-13966520 TTGGTGGGGAGGTGGTGAAAGGG - Intergenic
987817902 5:22928095-22928117 TTGTAGGGAAGGAGGTCAAGAGG - Intergenic
988859924 5:35267177-35267199 TTGGTGGGAGCAAGGTGAATGGG + Intergenic
991596383 5:68311001-68311023 TTGGTGGAATTGAGGTCAATGGG - Intergenic
992589328 5:78277355-78277377 TTGGTGGGAGGGAGTTTAAGGGG + Intronic
992928328 5:81614669-81614691 TTGGTTGGGAGGAAGTGAATTGG - Intronic
993107983 5:83622060-83622082 TGGGTGAGAAGGAGGAAAATAGG + Intergenic
994084905 5:95747372-95747394 GTGGTGTGGAGAAGGTTAATTGG - Intronic
995337048 5:111011559-111011581 TCTGTGGGAAGGAGGCTGATGGG - Intergenic
995943663 5:117615459-117615481 TTGATGGGAAAGAGATTAACTGG + Intergenic
996322711 5:122237091-122237113 TTGGTGGGAAGCAGGGGAGTAGG + Intergenic
998360020 5:141577227-141577249 TTGGAGGGGAGTAGGTAAATAGG - Intronic
999326833 5:150649155-150649177 ATGGTGGAAAGGAGGATGATGGG + Exonic
1001649361 5:173304409-173304431 TTGGAGAGAAGGAGGCAAATTGG - Intergenic
1002958593 6:1893074-1893096 CAGGTGGGAAGGAGGTGGATGGG - Intronic
1003830123 6:10000100-10000122 TTGATGGGAAGGGGGTTATGTGG + Intronic
1004351361 6:14893079-14893101 ATGGAGGGAAGGAGGAGAATGGG + Intergenic
1005032161 6:21519957-21519979 TTGGTGGGAATGAGAAAAATAGG - Intergenic
1007280018 6:40705068-40705090 TGGGTGGGTAGGAGGTTACCAGG - Intergenic
1007359729 6:41346342-41346364 GTGGTGGGAATGAGATTAAGAGG - Intronic
1007427045 6:41753930-41753952 TTGGTGGAAAGGAGGTGTACTGG + Intronic
1007505626 6:42333038-42333060 GTGATGGGTTGGAGGTTAATAGG + Intronic
1010444554 6:75935592-75935614 TTGGTGGCGAGGAGGTGAAGGGG + Intronic
1011255368 6:85415087-85415109 TTTGTGTGCAGGAGGTTAATTGG - Intergenic
1011737875 6:90330987-90331009 TTGGTGGGGAGGAGGAGGATGGG + Intergenic
1012457595 6:99424874-99424896 CTTGTGGGAAGGGGGTTCATGGG - Intronic
1013957925 6:115861869-115861891 TTTGTGAGGAGGAGGTTATTAGG - Intergenic
1015386830 6:132634242-132634264 TTGTTAGGAAGGAGGATACTGGG + Intergenic
1016050811 6:139528097-139528119 GTGGGGGGAAGGAGGTAGATGGG + Intergenic
1018677454 6:166235540-166235562 TGGGTGGAAAGGGGGTTACTGGG - Intergenic
1018781318 6:167068695-167068717 TTGGTGGGAATGTGGTGAAAAGG - Intergenic
1018784831 6:167099819-167099841 TTGCTAGGGAGGATGTTAATGGG + Intergenic
1019019024 6:168902250-168902272 TCGCTGAGAAGGAGGTTGATTGG - Intergenic
1019108550 6:169690554-169690576 GTGCTGGGAAGGAGGTGGATGGG - Intronic
1020035280 7:4959950-4959972 TTGGTGGGAAGAAGGGGAACTGG + Intergenic
1022659185 7:32350253-32350275 CAGGAGGGAGGGAGGTTAATGGG - Intergenic
1022797315 7:33742430-33742452 AGGGTAGGCAGGAGGTTAATGGG + Intergenic
1022865800 7:34418551-34418573 TTGGTGGTGAGGATGTTAAACGG + Intergenic
1023393607 7:39732884-39732906 ATGGCGGGAAGGAGGAGAATTGG - Intergenic
1024710018 7:52004997-52005019 TTCTTGGGATGGGGGTTAATTGG + Intergenic
1026451953 7:70537171-70537193 CTGGTGGGAAGGAGGTGGAGGGG - Intronic
1026614039 7:71885972-71885994 TTGTTGGGAAGGAATTAAATCGG - Intronic
1026676381 7:72431955-72431977 ATGATGGCAAGGAGTTTAATAGG - Intronic
1028088546 7:86668607-86668629 TTGGAGGGAAGGAGGAGAAGAGG + Intronic
1029440740 7:100585463-100585485 TCGGTGGGACGGGGGTTAAGAGG + Intronic
1029453313 7:100654958-100654980 ATGGTGGGAAGGAGGTGCAGTGG + Intronic
1031216781 7:118903001-118903023 TTGGTGGGAGGGTGGAAAATGGG - Intergenic
1031751663 7:125582460-125582482 TTGGTGTCCAGGATGTTAATTGG - Intergenic
1032300344 7:130680625-130680647 TTGGGGGGAAGGAAGTGAAAGGG + Intronic
1032511827 7:132478900-132478922 TTGGTGGCAAGGAGGTTGGAAGG - Intronic
1033834115 7:145288148-145288170 TGGGTGGCAAGGAGCTGAATAGG + Intergenic
1034989448 7:155538790-155538812 GGGGTGGGCAGGAGGTGAATAGG - Intergenic
1035600768 8:895681-895703 GTGGTGTGAAGGAGGGTTATGGG + Intergenic
1037563446 8:20095730-20095752 TTGCTGGTGAGGAGGTAAATGGG - Intergenic
1039365272 8:36922299-36922321 TTTGTGGGAAGGAAGATATTTGG + Intronic
1041385552 8:57298267-57298289 TTGCTGGGAAAGACGTTAACTGG - Intergenic
1045404675 8:101853846-101853868 TTGGTGGAAAGGAGAGTAAATGG - Intronic
1045634981 8:104174353-104174375 TTGTTGGGGTGGAGGTTAAATGG + Intronic
1047372838 8:124270430-124270452 TTGGTGGGAGGGAGATGGATTGG - Intergenic
1048031863 8:130640742-130640764 TAGGAGGGACGGAGGTTAAAGGG - Intergenic
1048376278 8:133825390-133825412 ATGGTGGGAAGAAGGTGAAAGGG - Intergenic
1049469800 8:142770211-142770233 CTGGTGGGAAGGAGGGTCTTGGG + Intronic
1051522231 9:18001927-18001949 TGGGAGGGAAGGAAGTTGATAGG + Intergenic
1053098188 9:35347424-35347446 AGGCTGGGAAGGAGGTGAATTGG + Intronic
1055349512 9:75371961-75371983 TTGGTGGGAAGGTGGGTACCTGG - Intergenic
1055604296 9:77951753-77951775 TTTGTGGGAAGGTGGTGAAGGGG + Intronic
1055963360 9:81841809-81841831 TTGGTGGGGAGGGGGTTTAGAGG + Intergenic
1057469161 9:95342409-95342431 CTGGGGGGAAGGAGGTAACTAGG + Intergenic
1058170760 9:101678374-101678396 CTGATGAGAAGGAGTTTAATAGG + Intronic
1060141192 9:121211797-121211819 TTGGTGGGGAGGTGGTTATTGGG - Intronic
1060736112 9:126067460-126067482 TGGGTGGGAAGGAGGATTGTGGG - Intergenic
1186961782 X:14744567-14744589 TAGGAGGGAAGGAGGTGAAAAGG + Intergenic
1188117120 X:26258141-26258163 TGGGAGGGTAGGAGTTTAATTGG - Intergenic
1189113230 X:38315580-38315602 TGTGTAGGAGGGAGGTTAATGGG + Intronic
1189851895 X:45186096-45186118 TTTGTGGCAAAGAGGTTACTTGG - Intronic
1189896602 X:45663294-45663316 TTGGTTGGAGGGATGTTAAATGG - Intergenic
1190227264 X:48555757-48555779 TTGGTGGGGAGAAGGTCAGTAGG + Intronic
1191955703 X:66640281-66640303 TTGGTGGGAAAGGGCTGAATAGG + Intergenic
1193624576 X:83801956-83801978 TTGGTGAGAATGCGGATAATAGG - Intergenic
1195201015 X:102550089-102550111 GAGGTGGGTAGGAGGTTAAGGGG + Intergenic
1195254481 X:103079295-103079317 GAGGTGGGTAGGAGGTTAAGGGG - Intronic
1196411629 X:115425781-115425803 GTGGTGGGCAGGAGGTATATGGG - Intergenic
1197257347 X:124277317-124277339 TTGTTGGGTAGGATGTAAATTGG + Intronic
1197360085 X:125490949-125490971 TTGGAGGGCAGGAGGAAAATTGG + Intergenic
1199212140 X:145225098-145225120 TTTGTGGTAAGGTAGTTAATAGG + Intergenic
1199411541 X:147529313-147529335 CTGGTGGGAAGGAGGGTAGAAGG - Intergenic
1201310984 Y:12597957-12597979 TTGCTGGGGAGGAGGGAAATCGG + Intergenic
1201944583 Y:19497973-19497995 ATGTTGGGAAGGAGATCAATTGG - Intergenic