ID: 1108082438

View in Genome Browser
Species Human (GRCh38)
Location 13:46750657-46750679
Sequence TCTGAGCCCCCAATGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108082438_1108082443 14 Left 1108082438 13:46750657-46750679 CCCTTCTCCATTGGGGGCTCAGA 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1108082443 13:46750694-46750716 AGGATCCTGAACTCTGCTCCAGG 0: 1
1: 0
2: 0
3: 14
4: 190
1108082438_1108082441 -6 Left 1108082438 13:46750657-46750679 CCCTTCTCCATTGGGGGCTCAGA 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1108082441 13:46750674-46750696 CTCAGACTCTGCTCTCATCCAGG 0: 1
1: 0
2: 2
3: 28
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108082438 Original CRISPR TCTGAGCCCCCAATGGAGAA GGG (reversed) Intronic
901065368 1:6491648-6491670 CCTGAGGCCCCCATGGAGAAGGG - Intronic
903334150 1:22613890-22613912 TCTGAGCCCCCCACAGACAACGG + Intergenic
904825425 1:33271089-33271111 TCTGAGTGCCCAATGTAGAGGGG - Intronic
906534945 1:46546220-46546242 GCTGAGGCCCCACTGGAAAAAGG - Intronic
910531121 1:88236644-88236666 CCTCAGCCCCAAATGAAGAAAGG + Intergenic
911585878 1:99689814-99689836 TCTGAGCATCAAATGGGGAATGG - Exonic
915079096 1:153339149-153339171 TCTGAGACCTGAATGGAAAAAGG + Intronic
915624213 1:157105117-157105139 TCTCAGCCCCAAGTGGAGAGTGG + Intergenic
915675306 1:157524388-157524410 TCTCAGCCCCCTCTGGAGGAGGG - Exonic
916033643 1:160901609-160901631 ACTCAGCCTCCAAAGGAGAAGGG - Intergenic
916720944 1:167484395-167484417 TCTGGGCTCCCAAAGGGGAAGGG - Intronic
917980634 1:180266836-180266858 TCTGAGCCTACCATGGAGACAGG - Intronic
918656846 1:187037374-187037396 TCTGATCCCCTGAGGGAGAAGGG + Intergenic
922858563 1:228795944-228795966 TCTCAGCCCCACATGGAGAAGGG - Intergenic
1063681277 10:8189958-8189980 TCCAAGCCACAAATGGAGAATGG + Intergenic
1068831657 10:61502879-61502901 GCTGAGCTCTCAAAGGAGAATGG - Intergenic
1069558623 10:69414128-69414150 ACTGAGGCCGGAATGGAGAAAGG + Intronic
1076560532 10:131360404-131360426 TCTGCGCCAACAATAGAGAAGGG - Intergenic
1077201308 11:1309045-1309067 TCTGACTCCCGAATGGAGGAGGG - Intronic
1079079014 11:17401150-17401172 TCTGAGACACCAATTGAGAGAGG + Intronic
1079083922 11:17432102-17432124 TCTGAGGCCCCTGTGCAGAAAGG + Intronic
1081864755 11:46353430-46353452 CCTGGACCCCCAAGGGAGAATGG + Intronic
1082141177 11:48611275-48611297 TCTCAGCACACAATGGAGAAAGG + Intergenic
1085163672 11:74374744-74374766 ACTGAGTCCCCAAAGGAGAAAGG + Intronic
1085687035 11:78632921-78632943 TCTGAGCCACAGAAGGAGAAGGG + Intergenic
1086259784 11:84925054-84925076 TCTGAATCCTCAGTGGAGAAAGG - Intronic
1089251589 11:117166800-117166822 TCTGACAGCCAAATGGAGAATGG + Intronic
1089518597 11:119049112-119049134 GCTGAGGCCCCAGTGGAGGATGG - Exonic
1096497578 12:52047355-52047377 TGTGGGCCCTCAAGGGAGAATGG - Intronic
1098382407 12:69882732-69882754 TCTGAACCCCAAATGAAAAAAGG + Intronic
1098957005 12:76697988-76698010 TCTGAGCCCCTACTGGACACAGG + Intergenic
1103200331 12:119082853-119082875 TCTGAGCCTTATATGGAGAAGGG + Intronic
1105225815 13:18430550-18430572 TGTTTGCCCCCAATGGATAAAGG - Intergenic
1108082438 13:46750657-46750679 TCTGAGCCCCCAATGGAGAAGGG - Intronic
1108301289 13:49079103-49079125 TCTGAGCCTCCAATAAAGTAAGG - Intronic
1113564192 13:111308753-111308775 TCTGGGCAGCCAAAGGAGAAGGG + Intergenic
1114010269 14:18358900-18358922 TGTTTGCCCCCAATGGATAAAGG - Intergenic
1119184351 14:72629469-72629491 TCTGAGCCCTCAAGGGCTAATGG + Intronic
1121868452 14:97384737-97384759 GCTGTTCCCCCAATGGACAATGG + Intergenic
1123121370 14:105918533-105918555 TCAGAGCCCCCCATGGGGTATGG - Intronic
1128387629 15:67162013-67162035 TCTGGGGCCCCAAGGGAGGAAGG + Intronic
1128609266 15:69060851-69060873 TCTGGGCCCCCAACAGATAAGGG - Intronic
1132238604 15:100240169-100240191 TCTGGGCCCTTAATGGAGACTGG + Intronic
1133855163 16:9542838-9542860 TCTGGCCACCCCATGGAGAACGG - Intergenic
1135495792 16:22950069-22950091 CCTGAGCCCCCTCTGGAGAGAGG + Intergenic
1138277943 16:55749926-55749948 CCAGAAACCCCAATGGAGAAGGG + Intergenic
1144367802 17:14561373-14561395 TTTGAGGTCCCAATGGAAAAAGG - Intergenic
1144455952 17:15418385-15418407 TGTGTGCCTGCAATGGAGAAGGG - Intergenic
1151702267 17:75749849-75749871 CCTGAGCTGCCAAGGGAGAAAGG + Intronic
1152314456 17:79572221-79572243 TCTGAGCACCAAATGGACCATGG - Intergenic
1152892603 17:82891012-82891034 CCAGAGCCCCCACTGGAGAGGGG + Intronic
1154527560 18:15308971-15308993 TGTTTGCCCCCAATGGATAAAGG + Intergenic
1156160763 18:34355321-34355343 TCTGGGCATCCAATGAAGAAAGG - Intergenic
1157308183 18:46532073-46532095 TCTGGGCCCCTTATGGAGACAGG - Intronic
1157499151 18:48177905-48177927 TCTGAGGCCTCCCTGGAGAAAGG - Intronic
1159009506 18:63045352-63045374 TCTGAGTCTGCCATGGAGAAAGG - Intergenic
1159524834 18:69574909-69574931 TCAGAGTCCTGAATGGAGAAAGG + Intronic
1159958047 18:74533692-74533714 TCTGACCCACCAAAGAAGAAAGG + Intergenic
1161113015 19:2480127-2480149 CCTGAGCCCCAAGTGGAGACAGG + Intergenic
1161763313 19:6190313-6190335 ACTGTGCACCCAATGGAGGAGGG - Intronic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
1162785497 19:13032220-13032242 TCTGAGCCCCCAACTCAGAAAGG - Intronic
1163795065 19:19333164-19333186 TCATGGCCCCAAATGGAGAAGGG + Intronic
1165142285 19:33706986-33707008 TGTGAGGCCCCATTGGAGCAGGG - Intronic
1166210765 19:41305425-41305447 TCTGAGACCCCCAGGGAGCAAGG - Intronic
1166904966 19:46101618-46101640 GCTGAACCCCCACTGGGGAAGGG - Intergenic
1167347475 19:48955374-48955396 ACTGAGTCCCTGATGGAGAAAGG - Intronic
1167475980 19:49701179-49701201 TCGGAGACCCCAAGAGAGAAAGG - Intronic
927022944 2:19036292-19036314 TCTGAGCTTCCAAGGGAGACAGG + Intergenic
929537006 2:42790083-42790105 TCTGAGCCCCCAAACTAGACTGG + Intronic
929547240 2:42863640-42863662 TATGAGCCCACATTGGAGGAGGG - Intergenic
930102531 2:47614456-47614478 TCTGCACTCCCAATGCAGAATGG + Intergenic
931940954 2:67252013-67252035 TTTGAGCCCCTGAGGGAGAAAGG + Intergenic
932735811 2:74253495-74253517 CCTGAGCCTCCAAGGGCGAAGGG - Intronic
932820408 2:74894975-74894997 TTTGAGCCCCCAGTGGGAAATGG - Intergenic
932883616 2:75527426-75527448 TCTGACACCCCAGTGGAGAGGGG - Intronic
936109953 2:109656928-109656950 CAACAGCCCCCAATGGAGAAGGG + Intergenic
936403649 2:112184252-112184274 TCTGACCCACCAAGGGAGAACGG + Intronic
938526656 2:132140428-132140450 TGTTTGCCCCCAATGGATAAAGG + Intergenic
942144462 2:173012992-173013014 TCTCAGCTCACAATGAAGAAAGG - Intronic
944838726 2:203605292-203605314 TCAGAGCCACCAATAAAGAAGGG - Intergenic
945788984 2:214279469-214279491 TCTGAGCCACAACTCGAGAAAGG + Intronic
1169881532 20:10352069-10352091 TCTTAGCCCCCAAAGTAGCAGGG - Intergenic
1171773581 20:29346004-29346026 CCTGTGTCCCCAAAGGAGAAGGG - Intergenic
1172343104 20:34174816-34174838 TTAGAGACCCCAAAGGAGAAGGG + Intergenic
1173804016 20:45912224-45912246 TCCCAGCCCCCAAGGGAGGAGGG - Intergenic
1176769870 21:13059573-13059595 TGTTTGCCCCCAATGGATAAAGG - Intergenic
1178950412 21:36980925-36980947 CCTGAGCAGCCAGTGGAGAAGGG - Intronic
1179553524 21:42158187-42158209 TCTGAGAGCCCAGTGGGGAACGG + Intergenic
1180434765 22:15289701-15289723 TGTTTGCCCCCAATGGATAAAGG - Intergenic
950426191 3:12925929-12925951 TCTGAGGCCCCAAGGGAGAAGGG - Intronic
951654998 3:24996702-24996724 TCTGAGCAACCAAAGGATAAAGG - Intergenic
954448640 3:50559978-50560000 TCTGATCCCCCACTGGGAAAAGG - Intronic
958270603 3:91494370-91494392 GCTGAGCTCTGAATGGAGAAGGG - Intergenic
958636502 3:96753362-96753384 ACTGGGCCCCCAGTGGAGACGGG + Intergenic
959683061 3:109117936-109117958 TCTGCGCCCGCCATGAAGAAAGG - Intronic
966836008 3:184049982-184050004 TCTGAGAGCCCACTGGAGAAGGG + Intergenic
967230454 3:187332987-187333009 TCTAAGACCCCAATTGACAAAGG + Intergenic
969860681 4:10033299-10033321 GATGAGCCTCCAATGGAGACAGG - Intronic
970675546 4:18445066-18445088 TGTGAGTCCCCAAAGGAGAGAGG + Intergenic
971150028 4:24021880-24021902 AATGGGCCCCCAATGCAGAATGG + Intergenic
973111490 4:46403255-46403277 TCTCTGACTCCAATGGAGAAGGG + Intronic
974720872 4:65736654-65736676 TGTGAGCACCCAAGAGAGAAAGG + Intergenic
977664053 4:99624553-99624575 TCTGCCCACCCAGTGGAGAATGG + Intergenic
981982978 4:150818438-150818460 CCTGAGCCCCCAATCCAAAATGG + Intronic
982703825 4:158686224-158686246 TCTGAGCCCCAATAGCAGAAAGG + Intronic
986936050 5:12888109-12888131 TCTGAGGCTCCACTGGGGAATGG + Intergenic
988217555 5:28294622-28294644 TCTGAGCCCTGGATAGAGAAGGG - Intergenic
990431379 5:55738221-55738243 TCTGAGACCCCGAGGCAGAAAGG - Intronic
996208459 5:120774219-120774241 TCTTAGCTACCTATGGAGAAGGG + Intergenic
997141956 5:131391099-131391121 TCTGAGTACTCACTGGAGAAAGG - Exonic
999536101 5:152519042-152519064 TCTGAGACCCCACATGAGAATGG - Intergenic
1004026836 6:11827323-11827345 TCAGAGCCCCCAAAGGCCAAGGG + Intergenic
1005453598 6:25997990-25998012 TTTGAGTCACCACTGGAGAAAGG + Intergenic
1005790526 6:29295653-29295675 TCTGAGCCTGCAATGGCAAAGGG - Intergenic
1007663122 6:43498646-43498668 TCAGAGCCCACAAAGGAGAGTGG + Intronic
1007707287 6:43798632-43798654 ACTGAGGCCCCAAAAGAGAAGGG + Intergenic
1008021001 6:46577013-46577035 TTAGAGCCAGCAATGGAGAAGGG + Intronic
1008984541 6:57526975-57526997 GCTGAGCTCTGAATGGAGAAGGG + Intronic
1009172588 6:60419866-60419888 GCTGAGCTCTGAATGGAGAAGGG + Intergenic
1018512047 6:164534630-164534652 TCCGAGCTCACAATGCAGAATGG + Intergenic
1019358253 7:592114-592136 TCTGATCCCCCCATGGATCAGGG + Intronic
1020676750 7:11192809-11192831 TCTGAGGCCCATCTGGAGAATGG + Intergenic
1022611781 7:31882672-31882694 TGTAAGCCCCAAATGGAGAGAGG - Intronic
1024433108 7:49313703-49313725 TTTGAGTGCCCAAAGGAGAAGGG + Intergenic
1024922554 7:54574851-54574873 TCTCAGCCTCCCATGGAGAGAGG + Intergenic
1025839586 7:65133213-65133235 TCTGCAGCCCCAAGGGAGAAGGG - Intergenic
1025883481 7:65562752-65562774 TCTGCAGCCCCAAGGGAGAAGGG + Intergenic
1025889964 7:65639854-65639876 TCTGCAGCCCCAAGGGAGAAGGG - Intergenic
1028219635 7:88182030-88182052 TCTGAACCTCTAATGGAAAAAGG + Intronic
1029513444 7:101011117-101011139 CCAGAGCCCCCAGTGGAGAATGG + Intronic
1031852512 7:126882131-126882153 TCTGCAGCCCCAAGGGAGAAGGG + Intronic
1032496309 7:132365460-132365482 ACTGAGCCCCCAAAGGGGGAGGG - Intronic
1037256230 8:16958080-16958102 TGTGAGACCACAATGGTGAAAGG + Intergenic
1038483143 8:27915316-27915338 TCCGAGCCCCCAATGGAGGGTGG + Intronic
1045349243 8:101323067-101323089 TCTGAATCCCCAAAGTAGAAGGG + Intergenic
1046349779 8:112992707-112992729 TCTAAGTCAGCAATGGAGAAGGG + Intronic
1047377647 8:124317800-124317822 TCAGAGCCAGCAAGGGAGAAAGG - Intronic
1048866234 8:138763754-138763776 TCTGAGCCCCGAAGGGTGCAGGG - Intronic
1048918622 8:139207542-139207564 TCTGAGCCCTCCATGGGGCAGGG - Intergenic
1049196965 8:141320989-141321011 TCTGAGGCCCCAAAGCAGGAAGG + Intergenic
1050262955 9:3860420-3860442 GCTGAGCAAGCAATGGAGAAGGG - Intronic
1051410655 9:16786666-16786688 TCTGAACCCCAACTGCAGAAAGG + Intronic
1053055069 9:34989211-34989233 TCTTGCCCCCCAATGAAGAAAGG + Intergenic
1053705362 9:40747786-40747808 TGTTTGCCCCCAATGGATAAAGG + Intergenic
1054415438 9:64871393-64871415 TGTTTGCCCCCAATGGATAAAGG + Intergenic
1056447145 9:86677105-86677127 TCAGAGAACCCCATGGAGAAGGG - Intergenic
1060163848 9:121392335-121392357 ACTGAGCACCTAATGGAGAAAGG + Intergenic
1203561842 Un_KI270744v1:64248-64270 TCTCAGCCTCCGATGGAGAGTGG + Intergenic
1195647681 X:107250586-107250608 ACTGAGCCCCCAATAAATAAGGG - Intergenic
1197643800 X:128995469-128995491 GCTGAGCCCCAAATGAAGGATGG + Intergenic
1197858602 X:130946253-130946275 TCTGAGCTCCCCACAGAGAAGGG - Intergenic
1199430590 X:147755179-147755201 TCTGATCTCTCTATGGAGAAAGG - Intergenic
1200825228 Y:7631030-7631052 GCTGAGCCCTGAAAGGAGAATGG - Intergenic
1201161231 Y:11168722-11168744 TCTCGGCCTCCAATGGGGAATGG - Intergenic
1201351637 Y:13049916-13049938 TCTGAAGAACCAATGGAGAAGGG - Intergenic
1202234827 Y:22700056-22700078 GCTGAGCCCTGAAAGGAGAATGG + Intergenic
1202308332 Y:23496112-23496134 GCTGAGCCCTGAAAGGAGAATGG - Intergenic
1202562469 Y:26174474-26174496 GCTGAGCCCTGAAAGGAGAATGG + Intergenic