ID: 1108084569

View in Genome Browser
Species Human (GRCh38)
Location 13:46772653-46772675
Sequence ACTTATAAGCAGGAGCTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 444
Summary {0: 1, 1: 3, 2: 27, 3: 113, 4: 300}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108084569_1108084573 17 Left 1108084569 13:46772653-46772675 CCATTCAGCTCCTGCTTATAAGT 0: 1
1: 3
2: 27
3: 113
4: 300
Right 1108084573 13:46772693-46772715 GGTCTTTTTTTTTTTTGAGACGG 0: 24
1: 570
2: 7294
3: 118384
4: 92219
1108084569_1108084572 -4 Left 1108084569 13:46772653-46772675 CCATTCAGCTCCTGCTTATAAGT 0: 1
1: 3
2: 27
3: 113
4: 300
Right 1108084572 13:46772672-46772694 AAGTGAGAGCATGTGGTGTTTGG 0: 23
1: 802
2: 7703
3: 15866
4: 20410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108084569 Original CRISPR ACTTATAAGCAGGAGCTGAA TGG (reversed) Intronic
902956160 1:19925311-19925333 AGTTATTAGCAGGAAATGAATGG - Intergenic
903082155 1:20819611-20819633 ACTTATAGGTGGGAGCTAAATGG + Intronic
903235238 1:21946166-21946188 ACTTATAAGTGGGAGCTGGCCGG + Intergenic
904285650 1:29451789-29451811 ACTTGGAAGCAGGAGGTGAGTGG + Intergenic
904287902 1:29464755-29464777 TCTTAAAAGCAAGACCTGAAAGG - Intergenic
904414181 1:30345951-30345973 ACCTTAAAGCAGGAGCTTAAGGG - Intergenic
904419771 1:30384236-30384258 ACTTGGAAGCAGGAGGTGAGTGG - Intergenic
904627755 1:31816543-31816565 ACTTATAAGTGGGAGCTAAATGG - Intergenic
905847697 1:41246499-41246521 CTTTATAAGGAGCAGCTGAAAGG + Intergenic
906070722 1:43014561-43014583 ACTTATAAGTGGGAGCTAAGCGG + Intergenic
906393382 1:45438747-45438769 ACTTATAAGTGGGGGCTAAATGG - Intronic
907356786 1:53882137-53882159 ACTTATAAGTGGGAGCTGAATGG + Intronic
908854994 1:68416975-68416997 ACTTGTAAGTGGGAGCTAAATGG + Intergenic
909586140 1:77290897-77290919 AAATATAAGCAGGAGCACAATGG + Intronic
909970851 1:81987001-81987023 AGTTAAATACAGGAGCTGAAGGG - Intronic
910543309 1:88386107-88386129 ACTTATAAGTGGGAGCTAAGTGG + Intergenic
911425238 1:97701742-97701764 ATTTCTAAGCATGAGATGAAAGG + Intronic
911457039 1:98138495-98138517 ACTTATAAGCAGGAGCTAAACGG - Intergenic
911542310 1:99172458-99172480 ACTTATAAGTAGGAGCTAAATGG - Intergenic
912853992 1:113151216-113151238 ACTTATAAGTGGGAGCTAAATGG + Intergenic
914259125 1:145984164-145984186 ATTAATCAGCTGGAGCTGAAGGG - Intergenic
914371319 1:147027147-147027169 ACTTATGAGCAGGAGCTGAGAGG + Intergenic
916000345 1:160609012-160609034 AATTATAAGCTAGAGATGAAAGG + Exonic
916703829 1:167326019-167326041 AAGTATAAAAAGGAGCTGAAAGG - Intronic
916881259 1:169021564-169021586 ACTTATAAGTGGGAGCCAAATGG - Intergenic
917377204 1:174361998-174362020 ACTTGTAAGTGGGAGCTGAATGG - Intronic
917691287 1:177472070-177472092 GTTTATATGCAGGAGCTGCAGGG - Intergenic
918522467 1:185429972-185429994 ATTTATAAGTGGGAGCTAAATGG + Intergenic
919093851 1:193006091-193006113 ACTTACAAGTGGGAGCTAAATGG + Intergenic
919359411 1:196571967-196571989 AGTAAGAAGCAGGACCTGAAAGG + Intronic
919359763 1:196577765-196577787 ACTTAAAAGCAAGACCTAAAAGG + Intronic
919459140 1:197856049-197856071 ACTTATAAGTGGGAGCTAAAAGG + Intergenic
919576710 1:199319108-199319130 ACTTATAAGTGGGAACTAAATGG - Intergenic
920643517 1:207777552-207777574 ACTTATAAGTGGGGGCTAAATGG - Intronic
920679920 1:208064539-208064561 ATTTTTAAGCTGGAGGTGAATGG - Intronic
921527918 1:216241149-216241171 ATTGCTAAGCAGGAGGTGAAAGG + Intronic
921955401 1:220978255-220978277 ACTTAGAAGCAAGAGCTAATTGG - Intergenic
922331202 1:224577995-224578017 ACTTATGAGCAGGAGCTTGCAGG + Intronic
923101121 1:230818280-230818302 ACTTAGGAGCAGGGGCTGAGAGG - Intergenic
923196187 1:231670136-231670158 ACTTATAAGTGGGAGCTAAATGG + Intronic
924667354 1:246086941-246086963 ACTCATAAGTGGGAGCTGAACGG - Intronic
924840350 1:247703910-247703932 ACTTTTAAGTGGGAGCTAAATGG - Intergenic
1062849725 10:735056-735078 ACTTATCAGTGGGAGCTAAATGG + Intergenic
1063710207 10:8469977-8469999 ACTCATAAGTGGGAGCTAAATGG + Intergenic
1064509075 10:16069286-16069308 ACTTATAAGTGGGAGCTAAATGG + Intergenic
1064514924 10:16136681-16136703 ACTTATAAGTGGGAACTGAATGG - Intergenic
1064835175 10:19519326-19519348 ACATATAAGCATGAAGTGAAAGG + Intronic
1064852769 10:19728538-19728560 GCATACAACCAGGAGCTGAAGGG - Intronic
1064940443 10:20728483-20728505 ATTTAAAAGCAAGACCTGAAAGG + Intergenic
1065404833 10:25351964-25351986 ACTGATAAGTGGGAGCTGAATGG - Intronic
1066086973 10:31980545-31980567 ACTTATAAGTGGGAGCTAAATGG - Intergenic
1066244286 10:33567321-33567343 AGTAATAAGCTGGAGCTTAAAGG - Intergenic
1066436282 10:35399091-35399113 ACTTGAAAGCATGAGCTGATTGG + Intronic
1066562258 10:36682839-36682861 CCTTATAATCAGTAGCTTAAAGG - Intergenic
1068858160 10:61818769-61818791 ACTTATAAGTGGGAGCTAAATGG + Intergenic
1069195761 10:65549297-65549319 ACTTATAAGTGGGAGCTAAATGG + Intergenic
1069234202 10:66049719-66049741 ACTTATAAGTGGGAGTTAAATGG + Intronic
1070024198 10:72616303-72616325 GCTTAAAAGCAAGACCTGAAAGG - Intronic
1070115973 10:73529225-73529247 ACTTATAAGTGGGAGCTACATGG + Intronic
1071252211 10:83830469-83830491 TCTTAAAAGCAAGACCTGAAAGG + Intergenic
1071302795 10:84269296-84269318 AAATATGAGCAAGAGCTGAAGGG + Intergenic
1071408822 10:85366222-85366244 ACTTATAAGTGGGAGCTAAATGG - Intergenic
1072448439 10:95519571-95519593 AATTTTAAGCAAGAGCAGAAGGG + Intronic
1072889515 10:99310120-99310142 TCTTATAAGAAGGAGCTGGTAGG - Intergenic
1073943762 10:108728297-108728319 ATTTATAACCAGGACCTCAAAGG + Intergenic
1075015322 10:118906538-118906560 ACTTATAAGTGGGAGTTAAATGG + Intergenic
1075542027 10:123322108-123322130 ACTCATAAGTAGGAGCTAAACGG - Intergenic
1075596744 10:123737025-123737047 ACTTAGAAGTGGGAGCTAAATGG - Intronic
1075836341 10:125456640-125456662 ACTTATAAGTGGGAGCTAAATGG + Intergenic
1075864116 10:125703160-125703182 ACTTATAAGTGAGAGATGAATGG + Intergenic
1076506834 10:130983873-130983895 GCTTAGAAGCAAGACCTGAAAGG - Intergenic
1078027757 11:7714261-7714283 ATTTATAAGTGGGAGCTAAACGG - Intergenic
1079508518 11:21182927-21182949 ACTTACAAGAAGAAGCTAAAAGG + Intronic
1080724480 11:34881857-34881879 ACTTCTAAGTGGGAGCTAAATGG + Intronic
1081163580 11:39782662-39782684 AGTCAAAAGGAGGAGCTGAAGGG + Intergenic
1081222612 11:40480406-40480428 ATTTAAAAGTGGGAGCTGAACGG + Intronic
1081259939 11:40947381-40947403 GCTTAAAAGCAAGACCTGAAAGG - Intronic
1081281378 11:41212626-41212648 ACTTATAAGTGGGAGCTGAATGG - Intronic
1081362408 11:42196687-42196709 ACTTATAAGTGCAAGCTGAACGG - Intergenic
1081362696 11:42199926-42199948 ACTTATAAGAAGGAACTTAATGG + Intergenic
1081758070 11:45558841-45558863 ACTTATAGGCAGGGGATGGAGGG - Intergenic
1086411350 11:86547772-86547794 ACATATAAGCAGGAGTTGAGTGG - Intronic
1086614905 11:88804747-88804769 ACTTGTAAGTGGGAGCTAAATGG + Intronic
1087085159 11:94210822-94210844 ACTTATAAGTGGGAGCTGAATGG + Intergenic
1087097861 11:94337268-94337290 ACTTATAAGTGGGAGCTGAATGG + Intergenic
1087716615 11:101615750-101615772 ACTTATAAGCAGTTTCTCAATGG - Intronic
1088624257 11:111717858-111717880 ACGTATAAGTAGGAGTTGAATGG + Intronic
1089054463 11:115574335-115574357 ACTTATAAGTGGGAGCTGAATGG + Intergenic
1089597640 11:119591339-119591361 AGTTTTCAGCAGGAGCTGATAGG + Intergenic
1090249379 11:125240727-125240749 GCTTATAAGAAGGTTCTGAAGGG + Intronic
1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG + Intronic
1092399731 12:8164549-8164571 ACTTACAAGTGGGAGCAGAACGG - Intronic
1092483875 12:8884486-8884508 ATTTATAAGTGGGAGCTAAATGG - Intronic
1093385057 12:18542623-18542645 ACTTATAAGAGGGAGCTAAATGG - Intronic
1094759339 12:33512383-33512405 ACTTATAAGTGGGAGCTAAATGG - Intergenic
1095853554 12:46836310-46836332 ACTTATAAGTGGGAGCTAAATGG - Intergenic
1096338105 12:50772983-50773005 ACTTATAAGTAGGAGCTGAATGG - Intronic
1099126611 12:78767266-78767288 ACTTATATGTTGGAGATGAAAGG - Intergenic
1099662843 12:85587473-85587495 ACTTACAAGCGTGAGCTAAATGG + Intergenic
1099686456 12:85895593-85895615 ACTTATAAGTGGGAGCTAAATGG - Intergenic
1100145718 12:91675021-91675043 ATGTATAAGTGGGAGCTGAATGG - Intergenic
1100344014 12:93709476-93709498 ACTTTTTAGTGGGAGCTGAATGG - Intronic
1100908304 12:99328133-99328155 ACTGAAAAGCAGGAAATGAAGGG + Intronic
1100916086 12:99423764-99423786 ACTTATAAGTGGGAGCTAAATGG + Intronic
1101243521 12:102862324-102862346 ACTTGTAAGTGGGAGCTAAATGG + Intronic
1101313021 12:103601049-103601071 AATTACAAGCCAGAGCTGAATGG + Intronic
1102824518 12:115936805-115936827 ACTTAGAATCAGCAGGTGAAGGG + Intergenic
1103094223 12:118119862-118119884 ACCTTAAAGCAGGAGCTTAAGGG + Intronic
1103891727 12:124244005-124244027 ACTTATAAGTGAGAGCTAAACGG - Intronic
1104057768 12:125243771-125243793 ACTTACAAGTGGGAGCTAAACGG - Intronic
1104067630 12:125318581-125318603 ACTTATAAGTGGGAGCTGAATGG - Intronic
1104693684 12:130847234-130847256 TCTTAGAAGTAGGAGCTAAATGG - Intergenic
1104948245 12:132427064-132427086 ACAAATAAGCAGGAGCGGCAGGG + Intergenic
1105341057 13:19526418-19526440 ATTTTTAAGCTGGAGCTGGATGG - Intronic
1105385344 13:19924184-19924206 GGTGATAACCAGGAGCTGAAGGG - Intergenic
1106093308 13:26619189-26619211 ACTTATAAGCAGGTTGTGTATGG - Intronic
1106958397 13:34969613-34969635 ACTTGTAAGTGGGAGCTAAATGG - Intronic
1107117988 13:36767513-36767535 ACTGGTATGCAGGACCTGAAAGG + Intergenic
1108084569 13:46772653-46772675 ACTTATAAGCAGGAGCTGAATGG - Intronic
1108636699 13:52342508-52342530 ACTTATAAGTGGGCGCTGAATGG + Intergenic
1109029679 13:57176821-57176843 ACTTATAAGTGGGAGCTAAACGG - Intergenic
1109048906 13:57452166-57452188 ACTTAGAAAAAGGTGCTGAAGGG - Intergenic
1110817315 13:79876357-79876379 AGTTATAAGCAGGAGCTCCCAGG - Intergenic
1111416992 13:87959791-87959813 ACTTATCAGCAGCCTCTGAATGG - Intergenic
1114347224 14:21808739-21808761 ACCTTAAAGCAGGAGCTTAAGGG - Intergenic
1114373109 14:22111947-22111969 ACTTATAAGCATGTGCTACATGG + Intergenic
1114439736 14:22736632-22736654 ACCTTAATGCAGGAGCTGAAGGG - Intergenic
1114448119 14:22805540-22805562 ACTTATAAGTGGGAGCTGAACGG + Intronic
1115008807 14:28519572-28519594 ACTTATAAGTGGGAGCTGAATGG - Intergenic
1115044237 14:28970994-28971016 ACTTATAAGTGGGAGCTAAATGG - Intergenic
1115364787 14:32545851-32545873 ACTTTTAAGAATGATCTGAAAGG + Exonic
1115384246 14:32777150-32777172 ACTTAAAAGCAAGACCTGAAAGG + Intronic
1115385989 14:32797539-32797561 ACTTATAAGTGGGAGCTAAAAGG + Intronic
1116123546 14:40752515-40752537 ACTTATAAGTGGGAGCTGAATGG - Intergenic
1116302011 14:43195063-43195085 ACTTATGAATGGGAGCTGAATGG + Intergenic
1117262846 14:54054611-54054633 ACTTATAAGTGGGAGCTAAGTGG - Intergenic
1117287327 14:54299059-54299081 TCTTTTTAGCTGGAGCTGAAAGG + Intergenic
1118053989 14:62058997-62059019 ACTTATAAGTGGGAGCTAAATGG + Intronic
1121963854 14:98286364-98286386 ACTTACAAGTGGGAGCTAAATGG - Intergenic
1124447840 15:29754298-29754320 ACTTGTAAGTGGGAGCTAAATGG + Intronic
1124827219 15:33109616-33109638 ACTTATAAGCAAGAGCTACATGG + Intronic
1124865781 15:33489422-33489444 ACTTAAAAGTGGGAGCTAAATGG - Intronic
1126424519 15:48512539-48512561 ACTTTTAAGTGGGAGCTAAATGG - Intronic
1127512192 15:59653938-59653960 AGTTAGAAGGACGAGCTGAAAGG - Intronic
1128603075 15:69014393-69014415 ACTTATAAGCAGGGCCTGCCTGG + Intronic
1131187000 15:90283213-90283235 ACTCATAAGCATTATCTGAATGG - Intronic
1131572030 15:93548389-93548411 ACTTAAAAGTGGGAGCTAAATGG + Intergenic
1131740060 15:95379593-95379615 ACTTATAAGTGGGAGCTGAATGG + Intergenic
1132003126 15:98200176-98200198 ACTTATAAATGGGAGCTAAATGG - Intergenic
1134796598 16:17043130-17043152 ACTTATAAGTGGGAGCTTAATGG + Intergenic
1134841030 16:17401786-17401808 TTTTTTAAGCAGGAGCTGACTGG - Intronic
1135385953 16:22040194-22040216 ACTTATAAGTGGGAGCTAAATGG + Intronic
1138631553 16:58298503-58298525 ACTTATAAGTGGGAGCTAAATGG - Intronic
1138785782 16:59844745-59844767 ACCTATGAGTGGGAGCTGAATGG + Intergenic
1140053014 16:71499496-71499518 ACCTTAAAGCAGGAGCTTAAGGG + Intronic
1140618819 16:76701928-76701950 ACTTATAAATGGGAGCTAAACGG - Intergenic
1140705246 16:77622703-77622725 ACTTACAAGCGGGAGCTAAGCGG - Intergenic
1140903889 16:79394333-79394355 ACTTGTAAACAGGGTCTGAAAGG - Intergenic
1141689706 16:85589160-85589182 GCTTCCTAGCAGGAGCTGAAAGG + Intergenic
1143071370 17:4296844-4296866 ACTTAAAAGCAGGAACTTATAGG - Intronic
1144532734 17:16055451-16055473 ACTTATAAGCGGGAGCTAAATGG + Intronic
1148961672 17:51398303-51398325 CCTTGTAAGAAGGAGCCGAAAGG + Intergenic
1149022786 17:51989380-51989402 ACTTATAAGTGGAAGCTAAAAGG - Intronic
1150511202 17:65754861-65754883 ACTTGTAAGTGGGAGCTGAACGG + Intronic
1150855997 17:68753269-68753291 ACTTATAAGTGGGAGCTGGCTGG - Intergenic
1155133003 18:22957071-22957093 ACTTATAATCAGGAGATGTATGG + Intronic
1156067555 18:33162647-33162669 ACTTATAAATGGGAGCTAAATGG - Intronic
1156441941 18:37199311-37199333 ACTTGTAAGTGGGAGCTAAACGG - Intronic
1157002104 18:43539053-43539075 ACTCATAGGCAGGAGTTGAACGG - Intergenic
1157324913 18:46662044-46662066 ACTGGTATGCAGGACCTGAAAGG - Intergenic
1157378820 18:47192212-47192234 ACTAATAAGCAGCAACTGAGAGG - Intergenic
1157884664 18:51354980-51355002 CCTTATAAACAGAGGCTGAAGGG + Intergenic
1158138237 18:54228909-54228931 ACCTTAAAGCAGGAGCTTAAAGG - Intergenic
1159301891 18:66583556-66583578 ACTTATAAGTGGGAGCTAAATGG - Intronic
1159849265 18:73507277-73507299 ACTTATAAGTGAGAGCCGAAGGG - Intergenic
1160218860 18:76957730-76957752 ACTGATAAGTGGGAGCTAAATGG - Intronic
1162870005 19:13579170-13579192 ACTTGAAAGCAGAAGCTGCAAGG - Intronic
1164054772 19:21613333-21613355 ACTTATAAGTAGGAGTTGAATGG - Intergenic
1164709788 19:30347580-30347602 ACTTATCAGCAGGAGCCTACTGG + Intronic
1168189948 19:54730679-54730701 ACTCATATGCAGGAGCTAAAAGG - Intronic
925002723 2:418941-418963 ACTTACAAGTAGGAGATAAATGG + Intergenic
925203155 2:1985184-1985206 ATTGAGCAGCAGGAGCTGAAAGG - Intronic
925542491 2:4980689-4980711 ACTGATAAGGAGGAGCTGGAGGG + Intergenic
925968874 2:9093012-9093034 ACTTATCAGTAGTAGCTGCAAGG - Intergenic
929241654 2:39659660-39659682 ACTTATAAGTGGGAGCCAAATGG - Intergenic
929279973 2:40066851-40066873 ATTTATAAGTGGGAGCTAAAAGG - Intergenic
929740351 2:44593094-44593116 TCTTAAAAGCAAGATCTGAAAGG - Intronic
929907959 2:46062631-46062653 TCTTTTAAGTAGGAGTTGAAGGG + Intronic
930499553 2:52195386-52195408 ACTCATAAGTGGGAGCTAAATGG - Intergenic
931925716 2:67070371-67070393 ACTTGTAAGTGGGAGCTAAATGG + Intergenic
933510683 2:83237693-83237715 ATTTAGAAGCTGGAGATGAATGG + Intergenic
936035370 2:109106891-109106913 AGTTATAAGCAGGAGCAGTGTGG - Intergenic
937604740 2:123785378-123785400 ACTTAAATGCAAGACCTGAAAGG - Intergenic
938285898 2:130116567-130116589 ACTTATAGGTGGGAGCTAAATGG - Intronic
938429707 2:131222335-131222357 ACTTATAGGTGGGAGCTAAATGG + Intronic
938833403 2:135074847-135074869 ACTAAGAGGCAGGAGCTGGAGGG + Intronic
939076601 2:137609903-137609925 ACTTTGAAGATGGAGCTGAAAGG + Intronic
939087384 2:137737863-137737885 ACTTATAAGTATGAGCTGAATGG + Intergenic
940078666 2:149774070-149774092 ACTTATAAGTGGGGGCTAAATGG - Intergenic
940582546 2:155600527-155600549 ACTTGTGGGCAGGAGCTAAAGGG - Intergenic
940948956 2:159650356-159650378 TCTTAAAAGCAAGACCTGAAAGG - Intergenic
941993161 2:171576525-171576547 ACCTTAAGGCAGGAGCTGAAGGG + Intergenic
943152461 2:184131919-184131941 ACTTATAAGTGGGAGCTAAATGG - Intergenic
943158465 2:184215460-184215482 ACGTATAAGTGGGAGCTGAATGG - Intergenic
943395977 2:187335044-187335066 ACTTATAAGTGGGAGCTAATTGG + Intergenic
944368132 2:198948730-198948752 ACTTATGAGTGGGAGCTAAATGG - Intergenic
944772205 2:202925808-202925830 ACTTACAAGAAGCTGCTGAAAGG + Intronic
944906042 2:204263217-204263239 TCTTGAAAGCACGAGCTGAAAGG + Intergenic
945557683 2:211299721-211299743 ACCTTAAAGCAGGAGCTTAAGGG + Intergenic
945847679 2:214966162-214966184 ACTTATAAGTGGGAGCTGAATGG + Intronic
946979787 2:225197628-225197650 AAATATAAGCAGAAGCTAAATGG - Intergenic
948297471 2:236873116-236873138 CCGTATGAGCAGGAGATGAAAGG - Intergenic
1169578471 20:6992326-6992348 ACTTATAAGCTTGTGCTGAAAGG + Intergenic
1169667816 20:8057958-8057980 ACTTTTAAGCAGAGGCTTAAAGG + Intergenic
1169761300 20:9097669-9097691 AATTAAAAGCTGGAGGTGAATGG - Intronic
1170158331 20:13288394-13288416 ACTTTTCAGCTGGAGCTAAAAGG - Intronic
1171822546 20:29866997-29867019 ACTCATAAGCGGGTGCTAAAAGG + Intergenic
1173931646 20:46825799-46825821 ACTCATAAGTGGGAGCTAAATGG + Intergenic
1174512611 20:51065693-51065715 ACTTGTAAGTGGGAGCTGAATGG - Intergenic
1175587668 20:60157761-60157783 ACTTATAAGTGGGAGTTAAATGG + Intergenic
1177043459 21:16141620-16141642 ACTTATAAGTGGGAGCTAAATGG - Intergenic
1177082511 21:16658078-16658100 ATTTATAAGTGGGAGCTAAATGG + Intergenic
1177743289 21:25179558-25179580 ACTTATAAGTAAAAGTTGAAAGG - Intergenic
1178641562 21:34348813-34348835 ACTTATAAGTGGAAGCTAAATGG + Intergenic
1179253174 21:39691335-39691357 ACTTAGAAGCAATAGGTGAATGG - Intergenic
1180317453 22:11287896-11287918 ACTTATCTGCAGATGCTGAATGG - Intergenic
1182195568 22:28512701-28512723 ACTTGTAAGTGGGAGCTGAATGG + Intronic
1184901817 22:47451018-47451040 ACTTATTTGGATGAGCTGAAAGG + Intergenic
949698248 3:6724442-6724464 GATTATAAGCAGAGGCTGAAAGG - Intergenic
952026118 3:29084785-29084807 ACTTATAAGTGGGAGCTAAATGG - Intergenic
952188354 3:30995226-30995248 ACTTACAAGTGGGAGCTAAACGG + Intergenic
953061363 3:39430699-39430721 AGTTAAAAGCAGGAGGAGAAAGG + Intergenic
954602506 3:51880548-51880570 ACTCATAAGTGGGAGCTAAATGG + Intergenic
956220978 3:66902805-66902827 ACTTATAAGTGGGAGCTAAATGG + Intergenic
956236698 3:67079790-67079812 GCTTAAAAGCAAGACCTGAAAGG - Intergenic
956384811 3:68705265-68705287 ACTGATAAGTGGGAGCTGAATGG + Intergenic
957253699 3:77809628-77809650 ACTTAAAAGCAGCAGCTGAAAGG + Intergenic
959402517 3:105920794-105920816 ACTTATAAGTGGGAGCTGAATGG - Intergenic
959650437 3:108745568-108745590 ACTTATTTGCATGAGCAGAAGGG - Intronic
959976154 3:112462425-112462447 ACTTATAAGTGGGAGCTAAATGG + Intergenic
960138803 3:114132333-114132355 ACTCATAAGTGGGAGCTGAACGG + Intronic
960863463 3:122176561-122176583 ACTTATAAGTTGGAGCTGAATGG + Intergenic
962506651 3:136053056-136053078 ACTTATAAGTGGGAGCTAAATGG + Intronic
963223011 3:142831718-142831740 ACTTATAAGCAGCAAAGGAAAGG + Intronic
963456033 3:145549355-145549377 ACCTTAAAGCAGGAGCTTAAGGG + Intergenic
963686961 3:148447868-148447890 ACTCATAACCAGGACCTGAAGGG - Intergenic
963912721 3:150828526-150828548 TCTTATAGACAGGAGCTGATGGG + Intergenic
964932450 3:162043542-162043564 ATATATAAGTAAGAGCTGAATGG - Intergenic
965240298 3:166188561-166188583 ACTTATAAGTGTGAGCTGAATGG + Intergenic
966041446 3:175494508-175494530 ACTCATAAGCTGGAAATGAATGG + Intronic
966700006 3:182839208-182839230 ACTTATAAGTGGGAGCTAACTGG + Intronic
969780366 4:9397046-9397068 ACTTACAAGTGGGAGCAGAATGG + Intergenic
970555187 4:17224789-17224811 ACTTACAAGTGGGAGCTAAATGG - Intergenic
971130694 4:23806428-23806450 ATTTCTAAACAGGAGATGAAAGG + Intronic
971791345 4:31173698-31173720 ACTTATAAGTGGGAGCAAAATGG - Intergenic
972096097 4:35349125-35349147 AGTTATAAGTGGGAGCTAAATGG + Intergenic
972910672 4:43812736-43812758 ACTTATAAGTGGGAGCTAAATGG + Intergenic
974140308 4:57878364-57878386 ACTTATAAGAATGAGCTAAATGG + Intergenic
974219971 4:58955645-58955667 TCTTAAAAGCAAGACCTGAAAGG - Intergenic
974748538 4:66106516-66106538 ACTTATAAGCGGAAGGTTAATGG - Intergenic
975684058 4:76902341-76902363 ACTTAGAAGGAGCAGCTGGAGGG + Intergenic
975825143 4:78311577-78311599 ATTTATACCCAGGAGCAGAATGG + Intronic
976385627 4:84454361-84454383 ACTTGGAAGCAGGAGTTGAAAGG + Intergenic
976396050 4:84556938-84556960 ACTTATAAGTGGGAGGTGAATGG + Intergenic
977027804 4:91842534-91842556 CCTTATAAGTGGGAGCTGGAAGG + Intergenic
978273973 4:106926445-106926467 TTTTATAGGCAGGAACTGAAAGG - Intronic
979505401 4:121489890-121489912 GATTATAAGGAGGAGCTGAAAGG + Intergenic
979535496 4:121815528-121815550 ACTAATAAGCAGGAGAAAAATGG + Intronic
979985903 4:127314351-127314373 ACTAATAAGTAGGAGCTAAATGG + Intergenic
980147960 4:129013205-129013227 ACTTATAAGTGGGAGCTAAATGG - Intronic
980341623 4:131556289-131556311 ACTTATAAGTGGGAGCTAAATGG + Intergenic
980497406 4:133604421-133604443 ACTTAAAAGTAGGAGCCCAAAGG + Intergenic
981127570 4:141124044-141124066 ACCTTAAAGCAGGAGCTGAAGGG - Intronic
981302116 4:143199200-143199222 ACTTATAAGCGGGAGCTAAATGG - Intronic
981798422 4:148627112-148627134 ACATAGAAGCAGGAGTAGAATGG + Intergenic
982156368 4:152525516-152525538 ACTTATAAGTGGGAGCTAAATGG - Intronic
982803805 4:159737490-159737512 ACTTATAAGTGGAAGCTAAATGG + Intergenic
982938246 4:161513764-161513786 ACTTATAAGTGGGAGCTAAATGG + Intronic
983433484 4:167681393-167681415 ACAGAGAAGCAGGAGCTGAGTGG - Intergenic
985955826 5:3265487-3265509 ACCTGTAAGCAGGACCTGAGTGG - Intergenic
986965308 5:13263109-13263131 ACTTATAAGTGGGAGCTAAAGGG - Intergenic
987446901 5:18031271-18031293 ACTTTTAAGTGGGAGCTAAATGG - Intergenic
987835782 5:23159588-23159610 ACCTTCAAGCAGGAGCTGAAGGG + Intergenic
988271083 5:29017631-29017653 TCTGATAAGCAGGAGCGGAGAGG - Intergenic
988349155 5:30078021-30078043 ACTTATAAGTGGGAGGTAAATGG + Intergenic
988492689 5:31718035-31718057 AGTTATAGGGAGGAGCTGACAGG - Intronic
988865486 5:35330245-35330267 ACTTATAAGTTGGAGCTAAATGG + Intergenic
989026916 5:37078260-37078282 ACTTATAAGTGGGAGCTGAATGG - Intergenic
991254319 5:64597675-64597697 ACTTGTAAGTGGGAGCTAAATGG + Intronic
991765892 5:69979036-69979058 TCTTAGAAGTGGGAGCTGAACGG + Intergenic
991781430 5:70139126-70139148 TCTTAGAAGTGGGAGCTGAACGG - Intergenic
991845128 5:70854108-70854130 TCTTAGAAGTGGGAGCTGAACGG + Intergenic
993183724 5:84588831-84588853 GGTTATAAGCAGGAGGTGGAAGG + Intergenic
993413397 5:87598169-87598191 ACTTATAAATGGGAGCTAAATGG - Intergenic
993747743 5:91622108-91622130 ACTTATAAGTGGGAGCTAAATGG + Intergenic
993858534 5:93105051-93105073 ACATATAAGCTGGATCTCAAAGG - Intergenic
994470657 5:100200723-100200745 ACTTATAAGAGGGAGCTGAATGG - Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
995571144 5:113483970-113483992 ACATATAAGCGGGAGCTAAATGG + Intronic
995738618 5:115330480-115330502 ACTTACAAGTGGGAGCTAAACGG + Intergenic
995887091 5:116907561-116907583 ACTTATAAGTGGGAGCTAAATGG - Intergenic
995919360 5:117292878-117292900 ACTTATAAGTTGAAGCTAAATGG - Intergenic
996487766 5:124056906-124056928 ACATGTGCGCAGGAGCTGAAGGG + Intergenic
996775031 5:127123333-127123355 ACTTAGAAGAAGGAGGTTAATGG - Intergenic
997010490 5:129871462-129871484 ACTTATAAGTGGGAGGTAAATGG + Intergenic
997785979 5:136714369-136714391 ACTTATAAGTGGGAGCTAAATGG - Intergenic
998343453 5:141439718-141439740 AATTATAAGCAGGAACGGAACGG + Intronic
999074614 5:148782110-148782132 ACTTATAAGTGTGAGCTGAATGG + Intergenic
1000058465 5:157631450-157631472 TCTTAAAAGCAAGACCTGAAAGG - Intronic
1002652709 5:180713422-180713444 ACTTATAAGTGTGAGCTAAATGG - Intergenic
1004097675 6:12574697-12574719 ACTTGTAAGCAGGAGGGTAAGGG + Intergenic
1004975763 6:20964574-20964596 GCTTATAAGTGGGAGCTGAATGG + Intronic
1005400609 6:25429490-25429512 ACTTATAAGACAGTGCTGAATGG + Intronic
1005715885 6:28547977-28547999 ACTTATAAGTGGGAGCTAAGTGG + Intergenic
1006211481 6:32399142-32399164 ACTTATAAGGGGGAGCTGATTGG - Intronic
1006658924 6:35622591-35622613 ACTTATAAGGAGCAGATGGATGG - Intronic
1007141240 6:39576674-39576696 ACCTAAGAGCAGGAGCTGACAGG - Intronic
1008208569 6:48692873-48692895 ACTTACAAGTGGGAGCTAAATGG + Intergenic
1008375004 6:50781470-50781492 AATCATAAGTAGGAGCTGGATGG - Intergenic
1009576535 6:65469700-65469722 ACTTAAAAAAAAGAGCTGAATGG - Intronic
1009722556 6:67491665-67491687 ACTTATAAGTGGGAGCTAAATGG + Intergenic
1010074582 6:71785532-71785554 ACCAATAAGCAGGATGTGAATGG + Intergenic
1011970405 6:93215107-93215129 ACTTATAAGTGAGAGCTAAACGG - Intergenic
1012395461 6:98791198-98791220 ACATATAAGAAGGGCCTGAATGG - Intergenic
1012825042 6:104137239-104137261 ACTTACAAGTGGGAGCTAAATGG - Intergenic
1013706666 6:112843193-112843215 ACTTACAAGTGAGAGCTGAACGG - Intergenic
1014533500 6:122588877-122588899 ACTTCTAATCAGCAGCAGAAAGG + Intronic
1015248059 6:131097469-131097491 ACTTATAAGTGGGAGTTAAATGG + Intergenic
1016050869 6:139528741-139528763 ACTTAAAAACAGGAAATGAAGGG + Intergenic
1016684700 6:146867971-146867993 ATTTATAAGTGGGAGCTAAATGG - Intergenic
1018003838 6:159602464-159602486 AGTTATCGCCAGGAGCTGAAGGG - Intergenic
1019063134 6:169271592-169271614 TCTTAAAAGCAAGACCTGAAAGG + Intergenic
1020644071 7:10792641-10792663 AATTATAAGAAGGTGCTTAAAGG - Intergenic
1021094485 7:16520049-16520071 ACTTATAAATGGGAGCTAAATGG - Intronic
1021833605 7:24644322-24644344 ACTTGTAAGTGGGAGCTAAATGG - Intronic
1023195722 7:37636561-37636583 ACTTATAAGTGGAAGCTGAATGG - Intergenic
1026113650 7:67478205-67478227 ACTTGTAAGTGGGAGCTAAAGGG - Intergenic
1026211066 7:68305683-68305705 ACTTACAAGTAGGAGCTAAATGG - Intergenic
1026548396 7:71345380-71345402 ATTTATAAGCAGGAGGCCAAAGG - Intronic
1027476083 7:78633168-78633190 ACTTATAAGTGGGAGCTAAATGG + Intronic
1027504303 7:78996434-78996456 ACTTATAAGTGGGAACTAAATGG + Intronic
1028285656 7:88995143-88995165 ACTGATAAGCAGGAGCAGACTGG + Intronic
1028316946 7:89414391-89414413 ACCTATAAGTGGGAGCTAAATGG - Intergenic
1030286388 7:107831275-107831297 CCTTATAAGAAGGAGGTGGAAGG + Intergenic
1030354039 7:108523589-108523611 ACCTTAAAGCAGAAGCTGAAGGG - Intronic
1031183184 7:118442855-118442877 ACTTATAAGTGGGAGCTAAATGG + Intergenic
1031240032 7:119226022-119226044 ACTTGTAAGTGGGAGCTAAATGG + Intergenic
1031774645 7:125892346-125892368 ACTTATAAGCAGAAGCGTCAAGG - Intergenic
1032958777 7:137005163-137005185 ACTGATAAGTATGAGCTTAATGG - Intronic
1033565479 7:142574627-142574649 ACTTATAAGAGGGAGCTGAATGG + Intergenic
1033691026 7:143737242-143737264 ACTGGTGATCAGGAGCTGAAAGG - Intergenic
1034902950 7:154919004-154919026 ACCTTCAAGCAGGAGCTGAAGGG - Intergenic
1035819786 8:2579028-2579050 ACTCATGAGCAGAAGCTGAATGG - Intergenic
1035889751 8:3330522-3330544 ACTTCTAAGCAGGAGCTAAATGG + Intronic
1036277787 8:7370990-7371012 ACTTACAAGTGGGAGCAGAACGG + Intronic
1036343738 8:7940903-7940925 ACTTACAAGTGGGAGCAGAACGG - Intronic
1036421288 8:8598347-8598369 ACTTATAAGTGGGAGCTAAATGG - Intergenic
1036763403 8:11528877-11528899 AATTATAAGTGGGAGCTGAACGG + Intronic
1036839077 8:12101671-12101693 ACTTACAAGTGGGAGCAGAACGG - Intergenic
1036860866 8:12347914-12347936 ACTTACAAGTGGGAGCAGAACGG - Intergenic
1037246299 8:16839550-16839572 ACTTATAAGTGGGAGCTAAATGG + Intergenic
1037453858 8:19044163-19044185 ATTGATAAGCAGGAGCCAAATGG - Intronic
1037526507 8:19729825-19729847 AGTTAGAAGGAAGAGCTGAACGG + Intronic
1039354585 8:36801003-36801025 ACCTTAAAGCAGGAGCTTAAGGG + Intronic
1040437442 8:47405131-47405153 ACTCATATGTAGGAGTTGAACGG + Intronic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1040583998 8:48722918-48722940 ACTTATAAGAGGGACCTAAAAGG + Intronic
1041814908 8:61959361-61959383 ACTGATAAGCAACAGCTGACTGG + Intergenic
1042523136 8:69735595-69735617 ACTTATAAGTAGGAGCTGAATGG + Intronic
1043541176 8:81264469-81264491 ACTTAAAAGTGGGAGCTAAATGG + Intergenic
1044222611 8:89686824-89686846 ACTTACAAGTGGGAGCTGAACGG - Intergenic
1044653267 8:94521269-94521291 ACTTACAAGTGGGAGCTGAACGG - Intronic
1044858314 8:96497439-96497461 TCCTAAAAGCAGAAGCTGAAGGG - Intronic
1044911339 8:97062689-97062711 ACTTATAAGTGGGAGTTAAATGG - Intronic
1045990665 8:108303093-108303115 ACTTGTAAGTAAGAGCTAAACGG - Intronic
1046012914 8:108572117-108572139 ACTAAAAAGCAGTAGCTGAATGG + Intergenic
1046562978 8:115863082-115863104 ACTTATAAGTGGGAGCTAAATGG - Intergenic
1046843069 8:118883012-118883034 ACTTGTAAGCAGAGGCAGAATGG + Intergenic
1047449202 8:124948272-124948294 TCTTAAAAGCAAGACCTGAAAGG + Intergenic
1050115669 9:2260868-2260890 AGTTTCAAGCAGGAGCTGACTGG + Intergenic
1050758857 9:9041429-9041451 ACTTATAAGTAGGAGCTAAATGG - Intronic
1050832745 9:10034639-10034661 ACTTATAAGTGGGAGCTAAATGG - Intronic
1051102130 9:13533650-13533672 ACTTATAAGTGAGAGCTAAAGGG - Intergenic
1051852452 9:21525401-21525423 ACTTATAAATTGGAGCTGAATGG - Intergenic
1052219526 9:26002585-26002607 ACTTATAAGTAGGAGCTATGAGG + Intergenic
1052377686 9:27735953-27735975 ACTTGTAAGTGGGAGCTAAATGG - Intergenic
1053338209 9:37297619-37297641 CCTTATAAGAAGGAGCTATATGG + Intronic
1054995538 9:71383918-71383940 ACTTATAAGCACTAGCAAAATGG - Intronic
1055133232 9:72799892-72799914 CTTTATAAGCAGGAGATAAAGGG + Intronic
1056514982 9:87341706-87341728 ACTGGGAAGCAGGAGCTGAAGGG - Intergenic
1058294469 9:103288140-103288162 ACTTATAAGTGGGAGCTGAATGG + Intergenic
1058769779 9:108219283-108219305 ATTTATAAGTGGGAGCTAAATGG + Intergenic
1059835726 9:118149992-118150014 TCTGAAAAGCAGGAGCTGAGTGG - Intergenic
1059890350 9:118795162-118795184 ACTTGTAAGTGGGAGCTAAATGG - Intergenic
1059895731 9:118862470-118862492 ACTTGTAAGTGGGAGCTAAATGG - Intergenic
1060354616 9:122893532-122893554 ACTTAACAGCAGGAGCTGTGTGG + Intronic
1185955833 X:4487960-4487982 ACCTTAAAGCAGGAGCTGAAGGG + Intergenic
1186384301 X:9093596-9093618 ACTTTAAAGCAGGAGCTGCAGGG - Intronic
1186605645 X:11087657-11087679 ACTTATAAGTGGTAGCTAAATGG - Intergenic
1187903207 X:24043657-24043679 ACTTATAAGTGGGAGCTGAGTGG + Intergenic
1187904449 X:24053206-24053228 ACTTATAAGTGGGAGCTGAGTGG + Intergenic
1188796708 X:34475782-34475804 ACTTATAAGTGGGAGCTAAAGGG - Intergenic
1188843278 X:35042307-35042329 ACTTATAAGTGGTAGCTAAATGG + Intergenic
1188909167 X:35824209-35824231 ACTTATAAGTGGGAGCTAAATGG - Intergenic
1188957944 X:36455858-36455880 ACTTATAAGCAGGAAGAGATGGG + Intergenic
1189100025 X:38179328-38179350 ATTTGCAAGCTGGAGCTGAATGG + Intronic
1189610453 X:42727886-42727908 ACTTATAAGTGGGAGCTAAATGG + Intergenic
1189634068 X:42986249-42986271 ACTTATAAGTAGAAGCTAAAGGG + Intergenic
1189692880 X:43635324-43635346 ACCTTAAAGCAGGAGCTTAAGGG + Intergenic
1189693462 X:43639857-43639879 ACCTTAAAGCAGGAGCTTAAGGG + Intergenic
1191603479 X:63036197-63036219 ACTTATAAGTGGGAGCTAAATGG - Intergenic
1191603552 X:63037212-63037234 ACTTATAAGTGGGAGCTAAATGG - Intergenic
1191944669 X:66519004-66519026 ACTTCTAAGTGGGAGCTAAATGG - Intergenic
1192028247 X:67479134-67479156 ACTTATAGGCAGGAGCTATATGG - Intergenic
1192992697 X:76477885-76477907 TCTTATAAGCAGCAGATCAATGG + Intergenic
1193013630 X:76707051-76707073 ACTTATAAGTGGGAACTAAATGG + Intergenic
1193294056 X:79813211-79813233 ACTTATAAGTGGGAGCTAAATGG - Intergenic
1193427844 X:81361567-81361589 ACTTACAAGTGGGAGCTAAATGG + Intergenic
1193455224 X:81724014-81724036 ACTTCCCAGCAGCAGCTGAATGG + Intergenic
1193478593 X:81997855-81997877 ACTTAAAAACAGGAGCTAAATGG + Intergenic
1193493662 X:82183668-82183690 ACTTATAAACGGGGGCTAAACGG - Intergenic
1193664206 X:84296200-84296222 ACTTATAAGTGGGAGCTGATTGG - Intergenic
1193722311 X:85001642-85001664 ACTTATAAGTGGGAACTAAATGG + Intergenic
1194348609 X:92796651-92796673 TCTTATAGGCAGCAGCTCAATGG - Intergenic
1194446731 X:93996705-93996727 ATTTATAAGTGGGAGCTAAAAGG - Intergenic
1194568095 X:95519278-95519300 ACTTATAAGTGGGAGCTAAATGG + Intergenic
1194773410 X:97932640-97932662 ACATATAAACTGGAGCTGAGAGG - Intergenic
1194887529 X:99335262-99335284 ACTTTTAAGTGGGAGCTAAATGG - Intergenic
1194931963 X:99900003-99900025 ACCTTTAAGCAGGACCTGGAGGG - Intergenic
1195288822 X:103411807-103411829 ACTTATATGTAGGAGCTAAATGG - Intergenic
1195548964 X:106144878-106144900 ACTTATAAGTGGGAGCTAAATGG + Intergenic
1196105517 X:111890934-111890956 ACTTATATGTGGGAGCTAAATGG - Intronic
1196164016 X:112518527-112518549 ACTTACAACCAGAAGGTGAAGGG + Intergenic
1196168456 X:112561375-112561397 ACTTATTAGTGAGAGCTGAATGG + Intergenic
1196885632 X:120242919-120242941 CCTTATTTGCAGGAGCAGAATGG - Intergenic
1196895843 X:120334727-120334749 CCTTATCAGTAGGAGCAGAATGG - Intergenic
1196941282 X:120778620-120778642 ATTTATAAGTGGGAGCTGAATGG + Intergenic
1197573884 X:128183636-128183658 ACTTATAAGTGGGAGCTGAATGG + Intergenic
1197621334 X:128753037-128753059 ACTTATAAGTGAGAGCTAAATGG - Intergenic
1197736383 X:129852045-129852067 GCATATAGGCAGGAGCAGAAAGG + Intergenic
1198838007 X:140824975-140824997 ACTTATAAGTGGAAGCTAAATGG - Intergenic
1199256379 X:145723096-145723118 ACTTATAAGTAGCAGCTAAATGG + Intergenic
1200656936 Y:5913279-5913301 TCTTATAGGCAGCAGCTCAATGG - Intergenic
1202591109 Y:26484171-26484193 ATTTTTAAGCTGGAGCTGGATGG + Intergenic