ID: 1108086202

View in Genome Browser
Species Human (GRCh38)
Location 13:46796353-46796375
Sequence TCAATTTGATAGGGTTGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 86}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108086195_1108086202 19 Left 1108086195 13:46796311-46796333 CCTCATTTGCCCATCTGCAAAAT 0: 1
1: 3
2: 28
3: 175
4: 1126
Right 1108086202 13:46796353-46796375 TCAATTTGATAGGGTTGCTCTGG 0: 1
1: 0
2: 1
3: 10
4: 86
1108086198_1108086202 10 Left 1108086198 13:46796320-46796342 CCCATCTGCAAAATGGGTATACA 0: 1
1: 1
2: 20
3: 137
4: 748
Right 1108086202 13:46796353-46796375 TCAATTTGATAGGGTTGCTCTGG 0: 1
1: 0
2: 1
3: 10
4: 86
1108086199_1108086202 9 Left 1108086199 13:46796321-46796343 CCATCTGCAAAATGGGTATACAG 0: 1
1: 0
2: 4
3: 83
4: 575
Right 1108086202 13:46796353-46796375 TCAATTTGATAGGGTTGCTCTGG 0: 1
1: 0
2: 1
3: 10
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108086202 Original CRISPR TCAATTTGATAGGGTTGCTC TGG Intronic
906240204 1:44238198-44238220 TCAATTTACGAGGGTGGCTCTGG - Intronic
906985567 1:50679399-50679421 TCTATTTAATAGGGTTACTGAGG - Intronic
909179999 1:72411619-72411641 TCTATTTCATGGGGTTGCTTTGG - Intergenic
909809450 1:79913314-79913336 TTAATATGTTAGGGTTGCTCAGG - Intergenic
910150368 1:84135406-84135428 TCAAATTGATAGTACTGCTCAGG - Intronic
910960138 1:92753031-92753053 TTAATTTGATAGGGTGGATAAGG + Intronic
916849571 1:168689754-168689776 TCACTTCCATAGGTTTGCTCAGG + Intergenic
917607175 1:176644035-176644057 TCAAATGGATAAGGTTGCTCTGG + Intronic
923972929 1:239226106-239226128 TCAGTTTGTTAGGGTTGGTTTGG + Intergenic
1065111411 10:22443951-22443973 TAAATTTTATAGGATTGCTGAGG - Intronic
1067783317 10:49225059-49225081 TCTACTTGATAAGGTTCCTCTGG + Intergenic
1072717984 10:97764313-97764335 TCTATTTCACAGGGTTGCTGAGG - Intergenic
1082918454 11:58465284-58465306 TCAAGTAAACAGGGTTGCTCAGG + Intergenic
1087284461 11:96249815-96249837 TCATTTTTATAGGCTTACTCTGG - Intronic
1088583684 11:111339005-111339027 TCAAGGTGATAGTGTTGTTCAGG - Intergenic
1088607690 11:111547197-111547219 TCAATTTGAAAGGGATGTTCTGG + Intronic
1091630981 12:2160788-2160810 TCGATTTGGTATGGTAGCTCTGG + Intronic
1108086202 13:46796353-46796375 TCAATTTGATAGGGTTGCTCTGG + Intronic
1108316221 13:49240290-49240312 TCTATTTCATAGGGTTGTTGTGG + Intergenic
1111410747 13:87873519-87873541 TCAAATGGATAGAGTTGTTCAGG + Intergenic
1112305470 13:98269505-98269527 TCAATTTCATAGGGCTGCTGTGG - Intronic
1113201558 13:107871938-107871960 TTGATTTGATAGGGTTGATTTGG + Intergenic
1116575726 14:46572925-46572947 TCAATGTGATAGAGTAGCTTGGG + Intergenic
1117527424 14:56623544-56623566 TCATTTTGATCAGGTAGCTCAGG - Intronic
1121577293 14:94998606-94998628 TCAATTTGATTGGCTTTATCTGG + Intergenic
1121940682 14:98067683-98067705 TCCATTAGACAGTGTTGCTCGGG - Intergenic
1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG + Intronic
1129021239 15:72521076-72521098 TCAAGGTGAAAGGGTTGCTTGGG - Intronic
1139356203 16:66368339-66368361 TGAAATTGGTAGGGCTGCTCAGG - Intronic
1141929173 16:87189734-87189756 TTAATTTCTTAGGGTTCCTCAGG + Intronic
1143758077 17:9080974-9080996 TTAATTTGCTAGAGTGGCTCAGG - Intronic
1152243549 17:79173288-79173310 TCCATTTGACAGCGTTGCTTTGG + Intronic
1165119951 19:33552592-33552614 ACAATTTGATTGGGTTCCCCAGG + Intergenic
1168026347 19:53646488-53646510 TCAATGGGATAGGGTTCCTTAGG - Intergenic
927943091 2:27118209-27118231 GCCATTTGACAGGGTTGCTGAGG - Intronic
928890283 2:36196534-36196556 TCAGGTTGATAGGCTTGCTCTGG + Intergenic
931390249 2:61836009-61836031 GCTATTTGAAAGAGTTGCTCAGG - Exonic
932459028 2:71870550-71870572 TGAATTTGATCGAGTTCCTCTGG - Intergenic
936722626 2:115271189-115271211 TCAATTTGATTAGGTTGATGTGG + Intronic
937250070 2:120518068-120518090 TCAACTTAATTGGGTTGCTCAGG + Intergenic
939702726 2:145413696-145413718 TCAATTGGATGGGATTGCACAGG + Intergenic
941846175 2:170135860-170135882 TCATTTTGCTAGGATTGCTTTGG - Intergenic
942185830 2:173424162-173424184 TCATTTTGATAGGTTTACTCTGG + Intergenic
942631087 2:177950260-177950282 TCAATTTGCTAGAGTTCCCCAGG + Intronic
945975941 2:216270814-216270836 TAGATTTGATAGGGTTGTTTGGG - Intronic
946880481 2:224172167-224172189 GCAAATTCATAGGGTTGCTATGG - Intergenic
1169916057 20:10685054-10685076 TCAACTTTATAGTGTTGCTGTGG - Intergenic
1170059298 20:12242757-12242779 TCTATTGGATAGCATTGCTCTGG - Intergenic
1173337207 20:42122472-42122494 TCAAGTGGACAGGGCTGCTCAGG + Intronic
1173828353 20:46062012-46062034 TGTATTTGATGGGGTTTCTCCGG - Exonic
1174784029 20:53416057-53416079 GCAATTTAGGAGGGTTGCTCTGG + Intronic
1178246519 21:30957969-30957991 GCAATGAGATAGGGTTGCTATGG + Intergenic
1179773108 21:43639588-43639610 TCATTTTGATAGGTTTGTTGTGG - Intronic
1183362354 22:37389350-37389372 TCAATTCCATAGGGTTGCGAGGG - Intronic
949311687 3:2706788-2706810 TAAATTTGGTAGGTTGGCTCTGG - Intronic
951276917 3:20698898-20698920 TCTATTAGATAGTGCTGCTCTGG + Intergenic
954442985 3:50531773-50531795 CCTACTTCATAGGGTTGCTCTGG + Intergenic
956735752 3:72236809-72236831 TCATTTTGAGAAGGTTCCTCTGG - Intergenic
972388327 4:38589173-38589195 TCAACATGATAGGTTGGCTCTGG - Intergenic
975941345 4:79650719-79650741 TCAATTTGAAAAGTTTGTTCTGG + Intergenic
978521777 4:109623558-109623580 TAAATAAAATAGGGTTGCTCTGG + Intronic
986369998 5:7070423-7070445 TCAATTTGATAGTTTTGGTTTGG + Intergenic
988933822 5:36063229-36063251 TCAATATGAAAGTGTTGCTCAGG - Intronic
990076113 5:51847791-51847813 TCTCCTTCATAGGGTTGCTCAGG - Intergenic
990119922 5:52438540-52438562 TCAATTTGCTAGAGTTCCCCAGG - Intergenic
991599509 5:68338372-68338394 TCAACTTCATAGTGTTGCTGTGG - Intergenic
995027226 5:107438333-107438355 TCTATTTGAGAGGGTTCATCAGG + Intronic
996183036 5:120443340-120443362 TCTATTAGAGAGGGTTGCTGTGG - Intergenic
996504485 5:124254108-124254130 ACAATTTGATAGGATTCTTCTGG - Intergenic
997987312 5:138512763-138512785 TCAATCTGATATGTTTGATCAGG - Exonic
1006561079 6:34913152-34913174 TCAATTTTACAGGGTTGTTAGGG - Intronic
1007408732 6:41649428-41649450 TCAATTTCATGGCGTGGCTCTGG + Intronic
1007918975 6:45588894-45588916 TCAATGTGATGGGGTTGATCAGG + Intronic
1008562424 6:52735838-52735860 TTTATTTGATGGGGTTTCTCTGG + Intergenic
1010516074 6:76773505-76773527 TCAATAAGCTAGGGCTGCTCAGG - Intergenic
1010900305 6:81420104-81420126 TCAATTTGATGGGGATGGTAGGG + Intergenic
1017038681 6:150289961-150289983 TCAATCTGATAAGGTAGCCCTGG + Intergenic
1018167657 6:161114139-161114161 TCCATGTGGTAGGGCTGCTCCGG + Intronic
1019739964 7:2667877-2667899 TCATTTTAATAGGATTGCCCTGG + Intergenic
1021437428 7:20636057-20636079 TCTATTGGATAGTGTTGTTCTGG + Intronic
1021585229 7:22200789-22200811 TCAAATTCCTAGGCTTGCTCTGG - Intronic
1030842620 7:114374889-114374911 TCATTGGGATTGGGTTGCTCAGG + Intronic
1031398056 7:121296632-121296654 TGGATTTGATACAGTTGCTCAGG - Exonic
1033445510 7:141418303-141418325 TCAATTTCATTGGGTTACTGGGG - Intronic
1034758699 7:153649990-153650012 TCAATTTGCTAATATTGCTCAGG - Intergenic
1036616835 8:10394542-10394564 TCAATCTGACAGAGCTGCTCAGG - Intronic
1047425157 8:124738710-124738732 GCATTCTGATAGAGTTGCTCTGG - Intergenic
1048065773 8:130966790-130966812 TCTATTTTATAGGGTTGGTGTGG + Intronic
1051679788 9:19595495-19595517 ACAATTTGACAGTTTTGCTCAGG + Intronic
1059225942 9:112673027-112673049 TCAATTTTATACGCTTTCTCAGG + Intergenic
1060671064 9:125470165-125470187 TTAATTTGATAGGATTTGTCAGG + Intronic
1061116598 9:128617350-128617372 ATAATTTGATAGGGCTCCTCAGG + Intronic
1186680833 X:11871820-11871842 TCAATTTAGTGGGCTTGCTCAGG + Intergenic
1189880107 X:45482123-45482145 TCATTTTGAAAGGATTACTCTGG + Intergenic
1190634984 X:52424679-52424701 CCTATTTGTTAGGGTTCCTCTGG - Intergenic
1192496907 X:71622286-71622308 TACATTTGATAGGGTTGCTCTGG + Intergenic
1195523468 X:105857972-105857994 TCAATCAGGTAGGGTTCCTCAGG - Intronic
1198806074 X:140496139-140496161 TGGATTTGATAGGGTTTGTCAGG + Intergenic