ID: 1108086923

View in Genome Browser
Species Human (GRCh38)
Location 13:46803490-46803512
Sequence CTGGAGGCCTAGACTTGCGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108086923_1108086931 29 Left 1108086923 13:46803490-46803512 CCGTCGCAAGTCTAGGCCTCCAG No data
Right 1108086931 13:46803542-46803564 ATCCCCATGACCTCCTCTTTGGG No data
1108086923_1108086930 28 Left 1108086923 13:46803490-46803512 CCGTCGCAAGTCTAGGCCTCCAG No data
Right 1108086930 13:46803541-46803563 GATCCCCATGACCTCCTCTTTGG No data
1108086923_1108086927 6 Left 1108086923 13:46803490-46803512 CCGTCGCAAGTCTAGGCCTCCAG No data
Right 1108086927 13:46803519-46803541 TGACCTACCTGCTTCAAGTTGGG No data
1108086923_1108086926 5 Left 1108086923 13:46803490-46803512 CCGTCGCAAGTCTAGGCCTCCAG No data
Right 1108086926 13:46803518-46803540 TTGACCTACCTGCTTCAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108086923 Original CRISPR CTGGAGGCCTAGACTTGCGA CGG (reversed) Intergenic
No off target data available for this crispr