ID: 1108086926

View in Genome Browser
Species Human (GRCh38)
Location 13:46803518-46803540
Sequence TTGACCTACCTGCTTCAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108086921_1108086926 9 Left 1108086921 13:46803486-46803508 CCCACCGTCGCAAGTCTAGGCCT No data
Right 1108086926 13:46803518-46803540 TTGACCTACCTGCTTCAAGTTGG No data
1108086919_1108086926 28 Left 1108086919 13:46803467-46803489 CCTGGAGATAGTGTCAGAACCCA No data
Right 1108086926 13:46803518-46803540 TTGACCTACCTGCTTCAAGTTGG No data
1108086922_1108086926 8 Left 1108086922 13:46803487-46803509 CCACCGTCGCAAGTCTAGGCCTC No data
Right 1108086926 13:46803518-46803540 TTGACCTACCTGCTTCAAGTTGG No data
1108086923_1108086926 5 Left 1108086923 13:46803490-46803512 CCGTCGCAAGTCTAGGCCTCCAG No data
Right 1108086926 13:46803518-46803540 TTGACCTACCTGCTTCAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108086926 Original CRISPR TTGACCTACCTGCTTCAAGT TGG Intergenic
No off target data available for this crispr