ID: 1108086928

View in Genome Browser
Species Human (GRCh38)
Location 13:46803522-46803544
Sequence GATCCCAACTTGAAGCAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108086928_1108086931 -3 Left 1108086928 13:46803522-46803544 CCTACCTGCTTCAAGTTGGGATC No data
Right 1108086931 13:46803542-46803564 ATCCCCATGACCTCCTCTTTGGG No data
1108086928_1108086937 14 Left 1108086928 13:46803522-46803544 CCTACCTGCTTCAAGTTGGGATC No data
Right 1108086937 13:46803559-46803581 TTTGGGTTCAATTAATTTGCTGG 0: 21
1: 76
2: 121
3: 117
4: 297
1108086928_1108086930 -4 Left 1108086928 13:46803522-46803544 CCTACCTGCTTCAAGTTGGGATC No data
Right 1108086930 13:46803541-46803563 GATCCCCATGACCTCCTCTTTGG No data
1108086928_1108086938 19 Left 1108086928 13:46803522-46803544 CCTACCTGCTTCAAGTTGGGATC No data
Right 1108086938 13:46803564-46803586 GTTCAATTAATTTGCTGGAGTGG 0: 22
1: 70
2: 142
3: 233
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108086928 Original CRISPR GATCCCAACTTGAAGCAGGT AGG (reversed) Intergenic
No off target data available for this crispr