ID: 1108086929

View in Genome Browser
Species Human (GRCh38)
Location 13:46803526-46803548
Sequence TGGGGATCCCAACTTGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108086929_1108086931 -7 Left 1108086929 13:46803526-46803548 CCTGCTTCAAGTTGGGATCCCCA No data
Right 1108086931 13:46803542-46803564 ATCCCCATGACCTCCTCTTTGGG No data
1108086929_1108086937 10 Left 1108086929 13:46803526-46803548 CCTGCTTCAAGTTGGGATCCCCA No data
Right 1108086937 13:46803559-46803581 TTTGGGTTCAATTAATTTGCTGG 0: 21
1: 76
2: 121
3: 117
4: 297
1108086929_1108086939 30 Left 1108086929 13:46803526-46803548 CCTGCTTCAAGTTGGGATCCCCA No data
Right 1108086939 13:46803579-46803601 TGGAGTGGCTCCCAGAACTCAGG No data
1108086929_1108086938 15 Left 1108086929 13:46803526-46803548 CCTGCTTCAAGTTGGGATCCCCA No data
Right 1108086938 13:46803564-46803586 GTTCAATTAATTTGCTGGAGTGG 0: 22
1: 70
2: 142
3: 233
4: 322
1108086929_1108086930 -8 Left 1108086929 13:46803526-46803548 CCTGCTTCAAGTTGGGATCCCCA No data
Right 1108086930 13:46803541-46803563 GATCCCCATGACCTCCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108086929 Original CRISPR TGGGGATCCCAACTTGAAGC AGG (reversed) Intergenic
No off target data available for this crispr