ID: 1108086930

View in Genome Browser
Species Human (GRCh38)
Location 13:46803541-46803563
Sequence GATCCCCATGACCTCCTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108086923_1108086930 28 Left 1108086923 13:46803490-46803512 CCGTCGCAAGTCTAGGCCTCCAG No data
Right 1108086930 13:46803541-46803563 GATCCCCATGACCTCCTCTTTGG No data
1108086925_1108086930 9 Left 1108086925 13:46803509-46803531 CCAGAACTTTTGACCTACCTGCT No data
Right 1108086930 13:46803541-46803563 GATCCCCATGACCTCCTCTTTGG No data
1108086929_1108086930 -8 Left 1108086929 13:46803526-46803548 CCTGCTTCAAGTTGGGATCCCCA No data
Right 1108086930 13:46803541-46803563 GATCCCCATGACCTCCTCTTTGG No data
1108086924_1108086930 12 Left 1108086924 13:46803506-46803528 CCTCCAGAACTTTTGACCTACCT No data
Right 1108086930 13:46803541-46803563 GATCCCCATGACCTCCTCTTTGG No data
1108086928_1108086930 -4 Left 1108086928 13:46803522-46803544 CCTACCTGCTTCAAGTTGGGATC No data
Right 1108086930 13:46803541-46803563 GATCCCCATGACCTCCTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108086930 Original CRISPR GATCCCCATGACCTCCTCTT TGG Intergenic
No off target data available for this crispr