ID: 1108086931

View in Genome Browser
Species Human (GRCh38)
Location 13:46803542-46803564
Sequence ATCCCCATGACCTCCTCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108086929_1108086931 -7 Left 1108086929 13:46803526-46803548 CCTGCTTCAAGTTGGGATCCCCA No data
Right 1108086931 13:46803542-46803564 ATCCCCATGACCTCCTCTTTGGG No data
1108086924_1108086931 13 Left 1108086924 13:46803506-46803528 CCTCCAGAACTTTTGACCTACCT No data
Right 1108086931 13:46803542-46803564 ATCCCCATGACCTCCTCTTTGGG No data
1108086928_1108086931 -3 Left 1108086928 13:46803522-46803544 CCTACCTGCTTCAAGTTGGGATC No data
Right 1108086931 13:46803542-46803564 ATCCCCATGACCTCCTCTTTGGG No data
1108086923_1108086931 29 Left 1108086923 13:46803490-46803512 CCGTCGCAAGTCTAGGCCTCCAG No data
Right 1108086931 13:46803542-46803564 ATCCCCATGACCTCCTCTTTGGG No data
1108086925_1108086931 10 Left 1108086925 13:46803509-46803531 CCAGAACTTTTGACCTACCTGCT No data
Right 1108086931 13:46803542-46803564 ATCCCCATGACCTCCTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108086931 Original CRISPR ATCCCCATGACCTCCTCTTT GGG Intergenic
No off target data available for this crispr