ID: 1108088032

View in Genome Browser
Species Human (GRCh38)
Location 13:46816585-46816607
Sequence AAGAGTGGCATGGGTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108088032_1108088040 19 Left 1108088032 13:46816585-46816607 CCCTCCTCACCCATGCCACTCTT No data
Right 1108088040 13:46816627-46816649 CTATTATACTCATAATTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108088032 Original CRISPR AAGAGTGGCATGGGTGAGGA GGG (reversed) Intergenic
No off target data available for this crispr