ID: 1108088429

View in Genome Browser
Species Human (GRCh38)
Location 13:46819605-46819627
Sequence GAGTGAAGGAAGGAGTATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108088423_1108088429 19 Left 1108088423 13:46819563-46819585 CCTAAAAGAGAAAAACAATTGAA No data
Right 1108088429 13:46819605-46819627 GAGTGAAGGAAGGAGTATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108088429 Original CRISPR GAGTGAAGGAAGGAGTATGG AGG Intergenic
No off target data available for this crispr