ID: 1108089163

View in Genome Browser
Species Human (GRCh38)
Location 13:46828659-46828681
Sequence CAGAGTTAAGACTCAGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108089163_1108089169 21 Left 1108089163 13:46828659-46828681 CCTGCACCTGAGTCTTAACTCTG 0: 1
1: 0
2: 1
3: 6
4: 171
Right 1108089169 13:46828703-46828725 AGACAAGATTATCTGAATAATGG 0: 1
1: 0
2: 2
3: 18
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108089163 Original CRISPR CAGAGTTAAGACTCAGGTGC AGG (reversed) Intergenic
900653617 1:3743953-3743975 CAGAGGTCAGCCTCAGGTGTGGG + Intergenic
904030899 1:27532834-27532856 CAGAGCCAAGCCTAAGGTGCTGG - Intergenic
907319796 1:53595036-53595058 CAGAGGGAAGGCTCAGGTGGGGG + Intronic
909844329 1:80372640-80372662 CAGGGGTAAGACTCTGGTGGAGG - Intergenic
911089764 1:94009224-94009246 CAGAGTAAAGACTCAGGGCCTGG + Intronic
911182879 1:94876675-94876697 CAAAGATGAGACTCAGGTGGTGG - Intronic
913597988 1:120396028-120396050 CAGAGTCAGGTCTCAGCTGCAGG - Intergenic
914089341 1:144483292-144483314 CAGAGTCAGGTCTCAGCTGCAGG + Intergenic
914309270 1:146450923-146450945 CAGAGTCAGGTCTCAGCTGCAGG - Intergenic
914512414 1:148345634-148345656 CAGAGTCAGGTCTCAGCTGCAGG + Intergenic
914592841 1:149122214-149122236 CAGAGTCAGGTCTCAGCTGCAGG + Intergenic
915691025 1:157690873-157690895 TAGAGCTAAGATTCAGGTGTAGG - Intronic
917796020 1:178533375-178533397 CAGAGATAAGTCTCGGGTCCAGG - Intronic
917864362 1:179179205-179179227 CAGAGTTAATCCTCATGTGGAGG - Intronic
918139729 1:181710154-181710176 CAGAGGGAACACTCAGGTGAAGG - Intronic
918379944 1:183943784-183943806 CATATTTAAGACTCAGCTCCCGG - Intronic
920067022 1:203276414-203276436 CATAGTTATGACACAGATGCTGG + Intergenic
924092583 1:240516770-240516792 CAGAATTAAGGCTCACTTGCTGG - Intronic
1063819493 10:9818886-9818908 CAGAGTGAAGACACAGAAGCTGG + Intergenic
1065691090 10:28334717-28334739 CACAGTTAAGACCCTGGTGATGG + Intergenic
1066468320 10:35672422-35672444 CAGAGTGAAGTTTCAGGGGCTGG + Intergenic
1068550930 10:58407186-58407208 CAGAGTAAAGACTCAGAAGTGGG - Intergenic
1071251825 10:83826645-83826667 AAGCGTTGAGACTCAGCTGCAGG - Intergenic
1071338526 10:84621652-84621674 AAGAGTTAAGACTTTGGTGGGGG + Intergenic
1072552398 10:96488769-96488791 CAGAGTGAAGACTCAAGTCCAGG + Intronic
1072558564 10:96546322-96546344 CAGAGTTCAGGCTCAGGTCTAGG - Intronic
1074982877 10:118633764-118633786 CAGAGATAAAACTCAGGAGGGGG - Intergenic
1075113791 10:119609113-119609135 CAGATTTGAGTCTCAGATGCTGG - Intergenic
1079455840 11:20635561-20635583 CAGACTTAATACTTAGGTGATGG + Intronic
1079911612 11:26317213-26317235 CAGAGTTCAGACTCAAGGTCAGG + Intronic
1084357158 11:68647565-68647587 CAGAGTTTAGACTCAGATTTGGG + Intergenic
1085203212 11:74714176-74714198 CAGAGTGAAGAACAAGGTGCGGG - Intronic
1085903359 11:80729211-80729233 CAGAGGTAAGAATGAGGTGAGGG - Intergenic
1088011530 11:105007388-105007410 CAGAGTTATGTCTTAGGTGAAGG - Intronic
1088517740 11:110656810-110656832 CAGAGTTGACATTCACGTGCGGG - Intronic
1089117366 11:116106800-116106822 CAGAGTCAAGATTCAGGCTCAGG - Intergenic
1089228679 11:116949918-116949940 CAGAGTTAGGGCTCTGGAGCTGG + Intronic
1089869209 11:121657221-121657243 CAGATTTAAAAGTGAGGTGCAGG - Intergenic
1090217793 11:124984817-124984839 CAGAGGGAAGACACAGATGCTGG - Intronic
1091692965 12:2609620-2609642 AAGCGTTAAGACTCAGGCGTTGG + Intronic
1093565420 12:20597349-20597371 CAAAGATAAGACTTAGGTGTTGG + Intronic
1094697687 12:32837290-32837312 CAGAGTTGAAACTCAAATGCCGG - Intronic
1096978344 12:55713440-55713462 CAGCGGTAAGACTCAGGCTCTGG + Intronic
1099602606 12:84760668-84760690 CAGATTTAAGAATGAGGTTCTGG + Intergenic
1101367478 12:104088146-104088168 CAGAGATAACTCTCAAGTGCAGG - Intronic
1107120670 13:36792157-36792179 CTGAGTTAAGACTCAAGCTCTGG + Intergenic
1107152322 13:37126142-37126164 CAGAGTCAACACTGAAGTGCTGG - Intergenic
1108089163 13:46828659-46828681 CAGAGTTAAGACTCAGGTGCAGG - Intergenic
1108212589 13:48153362-48153384 GAGAGCTATGTCTCAGGTGCGGG - Intergenic
1108391570 13:49952511-49952533 GTGGGTTAAGACTCAGGGGCAGG - Intergenic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1113739001 13:112698026-112698048 TAAAGTTAAGACTCCTGTGCTGG + Intronic
1113925720 13:113940387-113940409 CAGACAGAAGACGCAGGTGCTGG + Intergenic
1114571134 14:23669665-23669687 CAGAGTTCAGGCTCAGGCGGGGG + Intergenic
1116403128 14:44533513-44533535 CAGAGATAGGACTCAGGTGCTGG - Intergenic
1116740515 14:48748515-48748537 CACTGTGAAGACTCAGCTGCTGG - Intergenic
1117756320 14:58978145-58978167 CAGATTTAAGACTCAAGTCTAGG - Intergenic
1118131095 14:62964530-62964552 CAGAGTTAATATTCTGGTGGGGG - Intronic
1119870920 14:78016259-78016281 CAGAGTTAAGTCTCAGAGGATGG + Intergenic
1121359139 14:93240158-93240180 CAGAGTTAACACTAATCTGCAGG - Exonic
1122401571 14:101470417-101470439 CAGAGGTATGGCTCGGGTGCAGG + Intergenic
1123043078 14:105498526-105498548 CTGAGCCCAGACTCAGGTGCAGG - Intronic
1125371735 15:38985060-38985082 GAGAGCAAAGACTCAGGAGCCGG + Intergenic
1126163173 15:45632519-45632541 CAGAGTTAAGAAACATGTCCTGG - Intronic
1126664392 15:51063103-51063125 CAGAGCTAAAATCCAGGTGCTGG - Intronic
1129003567 15:72353757-72353779 CAGAGTAAAGACTCAGGGAGTGG + Intronic
1131455764 15:92581206-92581228 CAAAGATAAGACCAAGGTGCGGG + Intergenic
1132849675 16:2019427-2019449 CAGAGCGAAGGCCCAGGTGCAGG - Intronic
1133751628 16:8730463-8730485 CAGAGTACAGGTTCAGGTGCTGG - Intronic
1134117665 16:11561340-11561362 CAGAGTCAACACACAGGTGTGGG + Intronic
1134254045 16:12597112-12597134 CAAAGTCAGGACACAGGTGCTGG + Intergenic
1141204583 16:81923650-81923672 TGGTGATAAGACTCAGGTGCTGG + Intronic
1142776581 17:2144765-2144787 CAGACTCAAAACTCAGGTGAGGG + Intronic
1146057009 17:29586497-29586519 CAGGATGAACACTCAGGTGCAGG + Intronic
1146254790 17:31385516-31385538 GAGAGTTAAGAGGCAGGTGAAGG - Intergenic
1149012742 17:51874260-51874282 GAGAGTTAAGAATCAGGTTTGGG + Intronic
1151829536 17:76541404-76541426 CACAGGGAAGACTCAGGTGGCGG + Intronic
1152760519 17:82105000-82105022 CTGAGCTGAGGCTCAGGTGCAGG - Intronic
1157128930 18:44984496-44984518 AAGAGTTAAGCGGCAGGTGCAGG - Intronic
1157547325 18:48555588-48555610 CAGTGCTAAGACACAGGAGCTGG - Intronic
1160170222 18:76546760-76546782 CATACTTGAGACTCAAGTGCAGG - Intergenic
927450995 2:23209433-23209455 CAGAGAGGAGACTCAGGAGCTGG + Intergenic
928658488 2:33477518-33477540 CAGAGTTAATCATCAGCTGCAGG - Intronic
930516435 2:52413503-52413525 CTCAGTTATGACACAGGTGCTGG - Intergenic
931636280 2:64343425-64343447 AAGAGTTCAGGCTCTGGTGCTGG - Intergenic
932573866 2:72952084-72952106 CTGAGTTAGGCCTCTGGTGCTGG + Intronic
932866496 2:75348366-75348388 CAGATTTAAGACTTATCTGCAGG + Intergenic
933599661 2:84316709-84316731 CAGAATCAAGACTGATGTGCAGG + Intergenic
933741114 2:85534567-85534589 GAGTGTTAGGACTCAGGAGCAGG - Intergenic
934117240 2:88809449-88809471 CTGAGATAAGACTTGGGTGCAGG + Intergenic
937197235 2:120169635-120169657 CAAAGTTAAGACTGAGGTTGCGG - Intronic
939420806 2:141966039-141966061 AAGAGTTAAGACTCAGTAGATGG - Intronic
939803066 2:146737176-146737198 CAGAGTTCAGAGACAGGTGTAGG + Intergenic
941365755 2:164609286-164609308 CAGAATTAGGGCACAGGTGCTGG - Intronic
944142697 2:196474942-196474964 GAGAGTTGAGGATCAGGTGCGGG - Intronic
946419913 2:219558889-219558911 CAGAGTTTAAACTCTGGTGAGGG - Intronic
947969019 2:234306433-234306455 CAGGCAAAAGACTCAGGTGCAGG + Intergenic
1170802251 20:19600105-19600127 CAGAGTTGAGAATCAGGTCAGGG + Intronic
1171134180 20:22682385-22682407 CAGTGTTAAGACTCAGCAGTGGG - Intergenic
1173275002 20:41572695-41572717 CAGAGTTAATACACAGTTGCTGG - Intronic
1175099044 20:56565174-56565196 CAGAATTAAGGCTCAGGAGGAGG + Intergenic
1175742575 20:61430330-61430352 CTGAGTGCAGACTCAGGTGTGGG - Intronic
1178102330 21:29283303-29283325 CAGAGTTAAGAAGCTGGAGCTGG - Intronic
1179319918 21:40280831-40280853 CAGAGTTAAGACTGAGCGGGAGG - Intronic
1181882430 22:25991714-25991736 AAGAGTAAAGACTCACCTGCTGG + Intronic
1183700726 22:39449525-39449547 CAGAGTCAGGACTCAGATCCAGG - Intergenic
1184373741 22:44098729-44098751 CAGAGTTTACACTCTGCTGCCGG + Intronic
949819344 3:8099339-8099361 AAGAGCTAAGACACAGTTGCAGG + Intergenic
950139183 3:10603589-10603611 CAGAGTTCAGACTTAGCTCCTGG + Intronic
950151640 3:10692231-10692253 CAGAGTTAACACATAGATGCAGG + Intronic
956254605 3:67270650-67270672 CAGAGTTAAGAAAAAGGGGCTGG - Intergenic
956785201 3:72636793-72636815 CAAAGTCAAGACTCCAGTGCAGG - Intergenic
960570116 3:119177406-119177428 AAGAGTTAAGATTCAAGTCCAGG - Intronic
963346471 3:144100900-144100922 TGGAGTTAAGACTCAGATGCAGG - Intergenic
963380373 3:144522406-144522428 CAGTGAGAAGAGTCAGGTGCAGG + Intergenic
963853149 3:150227460-150227482 CAGAGTCAAGATTCAGGAGGTGG + Intergenic
966556898 3:181272534-181272556 GAGGGCTAAGATTCAGGTGCTGG - Intergenic
966650873 3:182299593-182299615 CAGAATTCAGACTCTGGAGCTGG + Intergenic
968483639 4:848494-848516 CAGAGTTAAGGGTCTGGGGCGGG + Intergenic
969443974 4:7233719-7233741 CAGAGACAGGACTCAGATGCAGG - Intronic
970284732 4:14498211-14498233 CAGAGTGAAGACACAGGTTAGGG + Intergenic
971916142 4:32872209-32872231 CAAAGATAAGACTCAGGAGGAGG - Intergenic
975968461 4:80004451-80004473 CAGGGTTAAAAATCAGGTGTTGG + Intronic
977482113 4:97592651-97592673 CAGAGGGAAGACACAGGTGCTGG + Intronic
977789096 4:101077021-101077043 CAGAGTGAAGACACAGAGGCAGG + Intronic
978402756 4:108348420-108348442 CAGGGTTTAAACTCAGTTGCAGG + Intergenic
979161388 4:117466073-117466095 CAGAGCTGAGATTCAGATGCAGG - Intergenic
982283930 4:153715155-153715177 AAGAGTGAAGTATCAGGTGCAGG - Intronic
985175460 4:187195258-187195280 AAGAGTCCAGACTGAGGTGCAGG - Intergenic
985761386 5:1751068-1751090 CAGAGTGACGATTCAGGTGTCGG - Intergenic
992765254 5:79992247-79992269 CAGAGTTAGAACTTGGGTGCTGG + Intronic
993617488 5:90131490-90131512 CTGAGGTAAGACTCAGATGATGG - Intergenic
997209448 5:132068886-132068908 CAGAGCAGAGACTCAGGAGCAGG + Intergenic
997440733 5:133907111-133907133 CAGAGCTACGACTCAGGGGCTGG - Intergenic
1000338672 5:160260598-160260620 GAGGGTCAAGACTCAGGGGCTGG + Intronic
1002347095 5:178555729-178555751 CGGAGTCAAGACTCAAGTCCAGG + Intronic
1002440284 5:179260874-179260896 CAGAGAGAAAACTAAGGTGCAGG - Intronic
1004240989 6:13922010-13922032 CAGAGCTGAGATTCAGGTCCAGG + Intergenic
1006519785 6:34564619-34564641 GAGAGTTGGGGCTCAGGTGCTGG + Intergenic
1008687917 6:53945306-53945328 CAGAGGGAAGACTCAGAAGCTGG + Intronic
1009923381 6:70091193-70091215 CAGAGTTAAGACTCGAATCCAGG - Intronic
1010255483 6:73752154-73752176 CAGAATCAAAACTAAGGTGCTGG - Intronic
1012628316 6:101431402-101431424 CAGAGTTTATATTCTGGTGCTGG + Intronic
1013268827 6:108527113-108527135 CAGAGTCAGGACCCAGCTGCAGG - Intergenic
1018974018 6:168550609-168550631 CACAGCTAAGACTCCGGGGCTGG - Intronic
1019289331 7:242684-242706 CAGACTTAAAACTCAGTTTCTGG + Intronic
1020828882 7:13067774-13067796 TAGAGTAAAAACTCAGCTGCAGG - Intergenic
1021258125 7:18419966-18419988 CAGATTACAGACTCAGGTACAGG + Intronic
1021839624 7:24712258-24712280 CAAAGTTATGACCTAGGTGCTGG - Intronic
1024775225 7:52777087-52777109 CAGAATAAAGCCACAGGTGCTGG - Intergenic
1030280583 7:107770552-107770574 CAGAGTTAAGAAACAGAGGCTGG - Intronic
1031156864 7:118120475-118120497 CAGATTTGTGACTCGGGTGCAGG + Intergenic
1033446115 7:141423638-141423660 CAGAATGAGGACTCAGATGCTGG + Intronic
1036080697 8:5552543-5552565 CAGAGTGAGGACTCAGATCCAGG - Intergenic
1036141847 8:6216115-6216137 AAAAGTTAAGAAGCAGGTGCTGG - Intergenic
1037823367 8:22146641-22146663 CAGGGATGACACTCAGGTGCTGG - Intergenic
1037900099 8:22683164-22683186 CAGAGTTGAGATTCAGATGTAGG + Intergenic
1038324585 8:26563008-26563030 CTGAGTTCAGACACAGGTGTGGG - Intronic
1039459874 8:37735279-37735301 CAGATTTAAGACTCAGGAAAAGG - Exonic
1039638767 8:39195122-39195144 CAGAGGGAAGACACAGATGCTGG - Intronic
1039923320 8:41907942-41907964 CAGAGGTAAGACTCAGCTCTGGG - Intergenic
1040102523 8:43518300-43518322 CAGTGCAAAGACACAGGTGCAGG + Intergenic
1044598677 8:93982284-93982306 CAGAGTTAGGACTCAAAAGCAGG + Intergenic
1044714793 8:95090303-95090325 CATACTTAAGTCACAGGTGCAGG - Intronic
1046776229 8:118166943-118166965 CAGAGTTTCCAATCAGGTGCTGG + Intergenic
1048183214 8:132215135-132215157 CTGAATTGAGACTCAGGTGTGGG - Intronic
1050146583 9:2574518-2574540 CAGAGCTTAGAATGAGGTGCAGG + Intergenic
1050893895 9:10860324-10860346 CAGAGTTAACACACAGGAACTGG - Intergenic
1053166008 9:35844324-35844346 CAGCGTTAAGACTGAGATGAGGG + Intronic
1055477684 9:76679033-76679055 CAGAGCCAAGATTCAAGTGCAGG - Intronic
1056197389 9:84241328-84241350 CACAGGTAAGACTCAGGGGAAGG + Intergenic
1060388367 9:123255685-123255707 GAGAAGTAAGACTCAGTTGCTGG - Intronic
1060547192 9:124468466-124468488 CCGAGGTCAGACGCAGGTGCAGG - Intronic
1061088446 9:128412568-128412590 CAGAGTCAAGCCTGAGGCGCTGG + Intronic
1188743915 X:33817923-33817945 CAGAGGAAAGACACAGGAGCTGG - Intergenic
1191208019 X:57854270-57854292 CAGAGGGAAGACACAGATGCTGG - Intergenic
1196814588 X:119654651-119654673 CAGAGCTGAGATCCAGGTGCAGG + Intronic
1197108140 X:122740256-122740278 CAGATTTAACACACAGGTCCTGG - Intergenic
1197141347 X:123121284-123121306 CAGAGGGAAGACACAGATGCTGG + Intergenic