ID: 1108089185

View in Genome Browser
Species Human (GRCh38)
Location 13:46828981-46829003
Sequence TTGTTCTTCAGGAAGCCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108089180_1108089185 13 Left 1108089180 13:46828945-46828967 CCCTTCAGGGAAATTGAACTCAA 0: 1
1: 0
2: 1
3: 18
4: 202
Right 1108089185 13:46828981-46829003 TTGTTCTTCAGGAAGCCTGAGGG 0: 1
1: 0
2: 2
3: 50
4: 261
1108089181_1108089185 12 Left 1108089181 13:46828946-46828968 CCTTCAGGGAAATTGAACTCAAA 0: 1
1: 0
2: 10
3: 428
4: 15982
Right 1108089185 13:46828981-46829003 TTGTTCTTCAGGAAGCCTGAGGG 0: 1
1: 0
2: 2
3: 50
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108089185 Original CRISPR TTGTTCTTCAGGAAGCCTGA GGG Intergenic
901013510 1:6214197-6214219 TTGTTGTTCATGAAGTCTGAAGG + Intronic
902459915 1:16566584-16566606 ATCTTCTTCAGGAGGCCTGAAGG + Intronic
902918343 1:19652129-19652151 TTGTTCCTGAGGAAGCAAGATGG + Intronic
903051735 1:20606169-20606191 TTATTCCTCCGGAAGCCTTAAGG - Intronic
903051902 1:20607376-20607398 TTATTCCTCCGGAAGCCTTAAGG - Intronic
903222422 1:21876230-21876252 TTGTCCCCCAGGAAGCGTGAAGG + Exonic
903845526 1:26277824-26277846 TTGTTCTCCCAGAAGCCTCAGGG + Exonic
905255389 1:36678499-36678521 TTTTGCTTAAGAAAGCCTGACGG + Intergenic
905417065 1:37811223-37811245 CAGTTCTTCAGAGAGCCTGAGGG + Exonic
909305780 1:74075114-74075136 GTGTTCCCCAGAAAGCCTGAAGG + Intronic
909394196 1:75151134-75151156 TTATTCTTCTGTAAGCCTAAAGG + Intronic
911217318 1:95209377-95209399 TTGTTCTTCAGCAAACATTAAGG + Intronic
912386464 1:109273429-109273451 TTCTTCTTAAGGATGCCTGTGGG - Exonic
912663981 1:111562477-111562499 TTTTTGTTCAGGAAATCTGATGG - Intronic
913605492 1:120461999-120462021 ATATTCTTCAGGAGGCCTGAAGG - Intergenic
913642358 1:120824719-120824741 ATATTCTTCAGGAGGCCTGAAGG - Intronic
913642537 1:120826259-120826281 ATATTCTTCAGGAGGCCTGAAGG - Intronic
913642717 1:120827799-120827821 ATATTCTTCAGGAGGCCTGAAGG - Intronic
913642833 1:120828846-120828868 ATATTCTTCAGGAGGCCTGAAGG - Intronic
913642910 1:120829617-120829639 ATATTCTTCAGGAGGCCTGAAGG - Intronic
913643449 1:120834348-120834370 ATATTCTTCAGGAGGCCTGAAGG - Intronic
913643677 1:120836370-120836392 ATATTCTTCAGGAGGCCTGAAGG - Intronic
914083049 1:144427223-144427245 ATATTCTTCAAGAGGCCTGAAGG + Intronic
914087367 1:144465246-144465268 TGGGTCTTGAGGAAGCCAGATGG - Intergenic
914177972 1:145295743-145295765 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914178517 1:145300505-145300527 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914179815 1:145311613-145311635 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914180361 1:145316383-145316405 GTAGTCTTCAGGAGGCCTGAAGG + Intronic
914180904 1:145321145-145321167 GTAGTCTTCAGGAGGCCTGAAGG + Intronic
914181447 1:145325895-145325917 GTAGTCTTCAGGAGGCCTGAAGG + Intronic
914181991 1:145330662-145330684 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914182536 1:145335418-145335440 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914183081 1:145340172-145340194 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914183626 1:145344926-145344948 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914184169 1:145349696-145349718 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914184713 1:145354460-145354482 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914185258 1:145359207-145359229 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914185803 1:145363961-145363983 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914186350 1:145368721-145368743 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914186894 1:145373469-145373491 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914187438 1:145378219-145378241 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914187982 1:145382975-145382997 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914188526 1:145387723-145387745 GTAGTCTTCAGGAGGCCTGAAGG + Intronic
914189068 1:145392479-145392501 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914193146 1:145428218-145428240 TGGGTCTTGAGGAAGCCAGATGG - Intergenic
914210922 1:145578188-145578210 ATATTCTTCAGGAGGCCTGAAGG + Intergenic
914269682 1:146068948-146068970 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914270221 1:146073676-146073698 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914270759 1:146078412-146078434 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914271296 1:146083142-146083164 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914271830 1:146087869-146087891 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914272368 1:146092587-146092609 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914272906 1:146097309-146097331 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914273444 1:146102031-146102053 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914273983 1:146106749-146106771 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914274520 1:146111459-146111481 ATATTCTTCAGGAGGCATGAAGG + Intronic
914275053 1:146116177-146116199 ATATTCTTCAGGAGGCATGAAGG + Intronic
914275591 1:146120903-146120925 ATATTCTTCAGGAGGCATGAAGG + Intronic
914276124 1:146125641-146125663 ATATTCTTCAGGAGGCCTGAAGG + Intronic
914311244 1:146468957-146468979 TGGGTCTTGAGGAAGCCAGATGG + Intergenic
914366699 1:146985558-146985580 ATATTCTTCAGGAGGCCTGAAGG - Intronic
914367235 1:146990319-146990341 ATATTCTTCAGGAGGCCTGAAGG - Intronic
914485748 1:148107887-148107909 ATATTCTTCAGGAGGCCTGAAGG + Intronic
914532519 1:148535629-148535651 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914533057 1:148540355-148540377 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914533592 1:148545069-148545091 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914534127 1:148549777-148549799 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914534662 1:148554485-148554507 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914535197 1:148559199-148559221 ATAGTCTTCAGGAGGCCTGAAGG + Intronic
914535734 1:148563944-148563966 ATATTCTTCAGGAGGCCTGAAGG + Intronic
914536269 1:148568660-148568682 ATATTCTTCAGGAGGCCTGAAGG + Intronic
914537165 1:148576588-148576610 ATATTCTTCAGGAGGCCTGAAGG + Intronic
914586079 1:149063038-149063060 ATATTCTTCAGGAGGCCTGAAGG + Intronic
914628759 1:149488758-149488780 ATATTCTTCAGGAGGCCTGAAGG - Intergenic
914629293 1:149493513-149493535 ATATTCTTCAGGAGGCCTGAAGG - Intergenic
914629827 1:149498270-149498292 ATATTCTTCAGGAGGCCTGAAGG - Intergenic
914630361 1:149503031-149503053 ATATTCTTCAGGAGGCCTGAAGG - Intergenic
914630895 1:149507792-149507814 ATATTCTTCAGGAGGCCTGAAGG - Intergenic
914631426 1:149512553-149512575 ATATTCTTCAGGAGGCCTGAAGG - Intergenic
914631959 1:149517309-149517331 ATATTCTTCAGGAGGCCTGAAGG - Intergenic
914632495 1:149522064-149522086 ATATTCTTCAGGAGGCCTGAAGG - Intergenic
914633030 1:149526815-149526837 ATATTCTTCAGGAGGCCTGAAGG - Intergenic
914633565 1:149531544-149531566 ATATTCTTCAGGAGGCCTGAAGG - Intergenic
914634101 1:149536299-149536321 ATATTCTTCAGGAGGCCTGAAGG - Intergenic
914634634 1:149541046-149541068 ATATTCTTCAGGAGGCCTGAAGG - Intergenic
914635169 1:149545783-149545805 ATATTCTTCAGGAGGCCTGAAGG - Intergenic
914635704 1:149550520-149550542 ATATTCTTCAGGAGGCCTGAAGG - Intergenic
914958446 1:152185421-152185443 TTGAGCTTCAGGGAGACTGAGGG + Intergenic
915252917 1:154603330-154603352 TTGGTCTTCAGGGAGCTGGAGGG + Intronic
915899794 1:159838421-159838443 CTGTTCTGCATGCAGCCTGAAGG + Intronic
920678338 1:208054308-208054330 TTGGTCTGCAAGAAGCCTGGTGG + Intronic
920979432 1:210819372-210819394 TTATTCTTCAGGAAGAGAGATGG + Intronic
921151617 1:212407518-212407540 TTGTTCTCCCGGGAGCCTTAGGG + Intronic
921176568 1:212600226-212600248 ATGTTTTTCAGGAAGACTGCTGG - Intronic
922040571 1:221892258-221892280 TTGTTCATCAAGCATCCTGAAGG - Intergenic
922454240 1:225762023-225762045 TCCTTCTTCAGGAAGCAGGAAGG + Intergenic
922581186 1:226699179-226699201 CTGTTCTGTAGGAAGGCTGAAGG + Intronic
922823124 1:228498028-228498050 CTGTTCTTCAGCAAGCCAGGTGG + Intergenic
923477495 1:234348219-234348241 TTGTTCTTCAGATATACTGAAGG - Intergenic
923857055 1:237856575-237856597 TTGTTCTTCAGACATACTGAAGG - Intergenic
1062947814 10:1474422-1474444 TGGGTCTTCAGAAAGACTGATGG + Intronic
1063026722 10:2186156-2186178 CTGTTTTTCTGGAAGTCTGATGG + Intergenic
1064516564 10:16155544-16155566 TAGGTCATCAGGAAGCCTGGGGG + Intergenic
1068392003 10:56409567-56409589 TTGTTCTTCAGGACCCCTCTCGG - Intergenic
1068637661 10:59365155-59365177 TTGTTCTTTAGTAAAGCTGAGGG - Intergenic
1068639979 10:59392598-59392620 TTATTCTTTAGGGAGACTGAAGG - Intergenic
1069324568 10:67217494-67217516 TTGTTCTTCATGAGGCGGGAAGG - Intronic
1069900406 10:71703635-71703657 TTGTTTGTCAGGATGCCAGAGGG + Intronic
1073471426 10:103724849-103724871 TCATTCTGCAGGAACCCTGAGGG + Intronic
1073759364 10:106613220-106613242 TGGTTCTCCAGGAAGCAAGATGG + Intronic
1074220010 10:111427194-111427216 GTGTTCTCCAGGGAGTCTGAAGG - Intergenic
1074477470 10:113785681-113785703 TTCTTCTCCAGCAAGACTGAAGG - Intergenic
1076747055 10:132519779-132519801 CAGTTCCTCAGGAAGCCTGGAGG + Intergenic
1078610418 11:12814502-12814524 TTTGGCTTTAGGAAGCCTGAGGG + Intronic
1079914227 11:26348635-26348657 CTGATCTTCAAGAAGTCTGAGGG - Intronic
1082795896 11:57377604-57377626 TTGTTCTTCAGTCAGCGGGAGGG + Intronic
1084790240 11:71470798-71470820 CTGTTCTTCAGGAACCTCGATGG + Intronic
1085348590 11:75783906-75783928 GTGAGCTTCAGGCAGCCTGAAGG - Intronic
1086514605 11:87597135-87597157 TTTTCCTTCAGGAAGCCCCAGGG - Intergenic
1086899352 11:92348989-92349011 TTCTACTTAAGGAAACCTGATGG - Intergenic
1088799976 11:113296759-113296781 TTTATCTTCAGGCAGCCTGCAGG - Intergenic
1089097988 11:115935632-115935654 TTGTTCTTCTGAAGGACTGAAGG - Intergenic
1090090257 11:123690433-123690455 TTTTTCTCCAGGTAGTCTGAGGG + Intergenic
1092149541 12:6237704-6237726 TTGATCTGAAGGAAGGCTGAGGG - Intronic
1094140215 12:27173009-27173031 TTGTTCTTCAGGCATACTCAAGG + Intergenic
1095256617 12:40044544-40044566 TCTTTCTTCATGAAGCCAGATGG + Intronic
1095495576 12:42780264-42780286 TGCTTCTTTAGGAAGCTTGAGGG + Intergenic
1096108618 12:49014837-49014859 TTGTTATTTAGGAACCCAGAAGG + Intronic
1098823553 12:75264618-75264640 TTTTTCTTCAAGAAGCCTTGTGG - Intergenic
1098972389 12:76869992-76870014 TGGTTCTGCAGGAATCATGAGGG - Intronic
1101480845 12:105095491-105095513 TTATGCCTCAGTAAGCCTGAGGG + Intergenic
1101753509 12:107602852-107602874 ATGTTTTCCAGGAAGCCTGCAGG - Intronic
1103539975 12:121659245-121659267 CTGTTGGTCAGGAAGGCTGAGGG + Exonic
1105325883 13:19370441-19370463 TTTGTTTTCAGGAAGCCTGTGGG + Intergenic
1105867624 13:24474653-24474675 TTTGTTTTCAGGAAGCCTGTGGG - Intronic
1106277105 13:28221005-28221027 TTGTACTCCAGGAGTCCTGAAGG + Intronic
1108089185 13:46828981-46829003 TTGTTCTTCAGGAAGCCTGAGGG + Intergenic
1112093945 13:96111991-96112013 TTCTTCTTCAGGAATACTTAGGG - Intronic
1112626771 13:101113930-101113952 CTGTTCATCAGGCAGCATGAGGG - Intronic
1114991353 14:28294071-28294093 GTGGTCTTCTGTAAGCCTGATGG + Intergenic
1116802884 14:49461809-49461831 ATGTGCTTCTGGAAGGCTGAAGG - Intergenic
1117726313 14:58677983-58678005 GTGGTCTTCAGGACGCTTGAAGG - Intergenic
1118721105 14:68594403-68594425 ATCCTCTTCAGGAAGCCTCAGGG + Intronic
1120106831 14:80505934-80505956 TTTCTCTTCTGCAAGCCTGAAGG - Intronic
1122160642 14:99781611-99781633 CTGTGCTTCAGGAAGACTGATGG - Intronic
1123456357 15:20430039-20430061 TTGTTCTTCAGGAACTGAGAAGG - Intergenic
1123661709 15:22570318-22570340 TTGTTCTTCAGGAACTGAGAAGG + Intergenic
1124315508 15:28664551-28664573 TTGTTCTTCAGGAACTGAGAAGG + Intergenic
1124650894 15:31473184-31473206 CTGTGCCTCAGGAAGCCAGAGGG - Intergenic
1125776209 15:42216838-42216860 TTTTTTTTCAGGAAGCCTTTTGG - Intronic
1128330282 15:66751164-66751186 TTATTCTGCAGGAAGTCAGAGGG + Intronic
1130271373 15:82451381-82451403 TTTTTCCTCAGGCAGCCTGTAGG + Intergenic
1130488961 15:84416066-84416088 TTTTTCCTCAGGCAGCCTGTAGG - Intergenic
1131727276 15:95240226-95240248 TTTTTTTTCAGGAAACCAGATGG - Intergenic
1133224311 16:4333340-4333362 GAGTTCAGCAGGAAGCCTGAGGG - Exonic
1133534335 16:6686356-6686378 TGATGCTTCAGGAAGCCTGTGGG + Intronic
1134821008 16:17247428-17247450 TTGTGGTTCTGGAAGCCTGCAGG - Intronic
1135108152 16:19669081-19669103 TTCTTCTTCACGTGGCCTGAAGG - Intronic
1137267356 16:46880269-46880291 TTGCTCTCGAGGGAGCCTGATGG - Intergenic
1138904448 16:61313981-61314003 TTCCTCTGCAGGAAGCATGAGGG - Intergenic
1139367460 16:66442196-66442218 TGGCTCTTCAGGAAGGCTGGAGG + Intronic
1139680526 16:68558368-68558390 TTGATCCTCAGGAACTCTGAAGG - Intronic
1140505878 16:75472288-75472310 TTTTTTTTTAAGAAGCCTGAGGG + Exonic
1140561560 16:75988235-75988257 TTGTTTTGCAGGAACCCAGATGG + Intergenic
1141138410 16:81481736-81481758 TTGTCTTTCTGGAAGCCTAAGGG + Intronic
1141561662 16:84872452-84872474 TTGTGGTTCAGGCAGCCTGCTGG - Exonic
1144666907 17:17108103-17108125 TTGTCCCTCAGGCTGCCTGAGGG + Intronic
1146718152 17:35103517-35103539 TGGTTCTTCAGGAACTGTGAAGG - Exonic
1148760247 17:49996185-49996207 GTGTGCTTCAGTAAGTCTGAGGG + Intergenic
1149749434 17:59130953-59130975 TTGTTCTTCAGTAAGTTTGAGGG - Intronic
1150669397 17:67177899-67177921 TTCTTCTCCAGGATGCCTTATGG - Intronic
1152662658 17:81550131-81550153 TTGTTCTTTTGCAAGGCTGACGG - Intronic
1152672322 17:81616365-81616387 TTGGTCTTGAGGAATCCTGAAGG - Intronic
1152780952 17:82227234-82227256 TTGTCCTTCAGGAGGCAGGAGGG + Intergenic
1152889254 17:82871039-82871061 TTTCTCATCAGGAAGCCAGAGGG - Intronic
1153924701 18:9825749-9825771 TCATTCTCCAGGAAGCCTGAAGG - Intronic
1153979550 18:10297413-10297435 TTGTTCTGCAAGGAGCCTTAGGG - Intergenic
1159090796 18:63846525-63846547 TTGTTCTGCATGAAGCCAGAAGG - Intergenic
1160360603 18:78273242-78273264 GTGTTCTTCAGGAAGACTGAAGG - Intergenic
1160918807 19:1510413-1510435 TTCTTCCCCAGGAAGCCTGAAGG + Exonic
1161654741 19:5507324-5507346 CTGTCCTTCAGGCGGCCTGACGG - Intergenic
1163125598 19:15242825-15242847 TTTGTCCTCAGGAAGCCAGAAGG - Intronic
1163260908 19:16189393-16189415 TTGCTGTGCAGGAAGTCTGATGG - Intronic
1164448400 19:28337330-28337352 AGGGTCTTCAGGAAGCCTCAGGG - Intergenic
1164639587 19:29813990-29814012 TAGTTCATCTGGAAGCGTGAAGG + Intronic
1166561246 19:43733718-43733740 TTGTTCTGCAAGAAGACTGAGGG + Exonic
1202676347 1_KI270711v1_random:10316-10338 ATCTTCTTCAGGAGGCCTGAAGG + Intergenic
925874937 2:8303566-8303588 TTGTTGTTGTGCAAGCCTGAGGG - Intergenic
927359081 2:22210476-22210498 TTGTTCATCATGATGGCTGAGGG - Intergenic
930028276 2:47043069-47043091 CATTTCTTCAGGAAGCCTGGCGG - Intronic
932852074 2:75197606-75197628 TGGCTCTTCAGGTAGCATGATGG - Intronic
932858207 2:75261102-75261124 CTGTTATTCAAGAAGCCTCAGGG + Intergenic
935147998 2:100409346-100409368 CTGTTCTCCAGGAAGCCAGGTGG + Intronic
935208119 2:100914240-100914262 TGGTATTTCAGGAAGGCTGAAGG - Intronic
936619712 2:114082728-114082750 TTGGGCTTCAGGGAGGCTGAGGG - Intergenic
937624477 2:124027053-124027075 GTGTTCTACAGGAAGGCTAAAGG + Intronic
937914216 2:127090940-127090962 TTGTTCTTCTGGATGCCTTCAGG + Intronic
939508836 2:143081782-143081804 TAGTTGTTCAGGAACTCTGAGGG + Intergenic
940659294 2:156526858-156526880 TTGGTCTTCAGGAAGCTGTAAGG + Intronic
941082902 2:161082374-161082396 TTTTGCCTCAGGATGCCTGAGGG - Intergenic
941256569 2:163239718-163239740 TTGTTTTTCTGTAAGCTTGAAGG + Intergenic
945560970 2:211339713-211339735 ATGTTCTTCTGGAAGCCTAATGG - Intergenic
946257391 2:218454923-218454945 TTGTTCCTCACAAGGCCTGACGG + Exonic
948054261 2:234999713-234999735 TTCTTCTTGAGCAAGTCTGAGGG - Intronic
1171377423 20:24702929-24702951 GACTTCTTCAGGGAGCCTGAGGG + Intergenic
1173468411 20:43302687-43302709 CTGATTTTCAGGAAGGCTGATGG + Intergenic
1176096774 20:63347912-63347934 TTTATCTACGGGAAGCCTGAAGG + Intronic
1179721480 21:43318717-43318739 TTGTTATTCAGGAAGAAGGATGG + Intergenic
1179800378 21:43808890-43808912 TTGTTCTTTAAGAAGGCTTAGGG - Intergenic
1180673502 22:17571242-17571264 TTGTCCCTCCGGATGCCTGAGGG - Intronic
1183054868 22:35299081-35299103 TTTTTCTTCAGAAAGGCTCATGG + Intergenic
1185078085 22:48694000-48694022 TCTTTCTTCAGGAAGCCCGTGGG + Intronic
950330639 3:12153469-12153491 TTGATCTTCAGGACTCTTGAAGG + Exonic
950360077 3:12443908-12443930 TTCTGCTTCAGAAATCCTGAGGG + Intergenic
951546491 3:23831314-23831336 ATGTTCTTCAGGCAGGCTGTGGG - Intronic
953249794 3:41234390-41234412 TAGCTCTTCAGGAAGACGGATGG - Intronic
953532838 3:43753632-43753654 ATATTATTCAGGAAGCCTAAGGG + Intergenic
953683005 3:45053434-45053456 CTGCTCTTCAGGAATGCTGAAGG - Intergenic
954005907 3:47590486-47590508 GTGTTCTTCAGCACCCCTGATGG - Intronic
955587570 3:60497803-60497825 ATGTACTTAAGGAAGCATGATGG - Intronic
957149889 3:76473037-76473059 TTGTTCATTATGAAGCCTTATGG - Intronic
959386718 3:105718142-105718164 TTATTCCTCAGAAATCCTGAAGG - Intronic
960118268 3:113920049-113920071 TTGTTGATGAGGAAGACTGAAGG + Intronic
960611101 3:119555495-119555517 ATGTTATTCAGGAAGCTGGAAGG - Intronic
962454302 3:135550957-135550979 TAGTTCTTCAGGAACCCTAACGG - Intergenic
962802616 3:138903156-138903178 GTCTTGTTCAGGAAACCTGAGGG + Intergenic
963699270 3:148603768-148603790 TTGTTCTTCAGGAAGAATAGAGG + Intergenic
964740807 3:159964006-159964028 TCAATCTTCAGGTAGCCTGAAGG + Intergenic
965690769 3:171354508-171354530 TTGTTTCTCAGGAAGCCCAAGGG - Intronic
966995168 3:185272629-185272651 GTTTTCTTTAGGAATCCTGACGG - Intronic
967149536 3:186636109-186636131 TGGGTCCTCAGGAACCCTGAAGG + Intronic
970707296 4:18820607-18820629 TGATTCTGCAGGAAGCATGATGG + Intergenic
971775517 4:30959617-30959639 TTTTTCTTCCAGAAGCCTGATGG + Intronic
974916310 4:68182679-68182701 TGGTTCTCCAGGAAGCCGCAGGG - Intergenic
976071409 4:81244104-81244126 TATGTTTTCAGGAAGCCTGATGG + Intergenic
976117363 4:81742513-81742535 TTGATATTCAGGAAGCCTGCAGG - Intronic
977376166 4:96206739-96206761 TTGACCTTCACGAAGCCAGAAGG - Intergenic
979010477 4:115361671-115361693 TTGGTCTTTAGTAAGTCTGAAGG - Intergenic
979365161 4:119813583-119813605 CTTTTCTTCAGGCATCCTGAGGG - Intergenic
980685610 4:136223851-136223873 TTGTTCTGCAGGAAGTAAGAAGG + Intergenic
981156061 4:141437558-141437580 GAGTTCTTCAGGCAGGCTGAAGG - Intergenic
981593536 4:146392545-146392567 TTGTTTTTCAGTAAATCTGAAGG - Intronic
982147290 4:152408973-152408995 TTGTTCTTTTGGGAGCCTTATGG - Intronic
982944374 4:161601168-161601190 TTGCTCTTCAGAAAGACTGGGGG + Intronic
983104135 4:163664544-163664566 TTGTTCCTAAGTAAGTCTGAGGG - Intronic
984321242 4:178199082-178199104 TTCTTCTGCTGGAAGCATGAAGG - Intergenic
984816248 4:183839538-183839560 TAGTACTACAGGAAACCTGAGGG + Intergenic
984891672 4:184499422-184499444 TTGTTCTTTGGGAATCCAGAAGG - Intergenic
986528711 5:8710516-8710538 TTGCTATTAAGGAAGACTGAAGG - Intergenic
987031875 5:13983673-13983695 GTGTCCTCCAGGAAGCCTGGGGG - Intergenic
987098505 5:14571468-14571490 TGGTTTTTCAGCAAGCCTCATGG - Intergenic
988860706 5:35275137-35275159 TTGTTCTTCAGACATACTGAAGG - Intergenic
989445488 5:41523771-41523793 TTCTTTTTCAGGAAGCATCATGG - Intergenic
990101503 5:52195339-52195361 TTGTTCTTCAGGTCTCATGAGGG + Intergenic
992921168 5:81522900-81522922 TTGCTCTTTTGGAAGCCTAAAGG - Intronic
992948566 5:81833888-81833910 TTTTCTTTCAGGAAACCTGAGGG - Intergenic
993996198 5:94726393-94726415 CTGTTCTTCAGTAAGCCTCATGG + Intronic
995033050 5:107500919-107500941 TTGTTCATCCTGAAGCCTGCAGG + Intronic
995479656 5:112581673-112581695 TGGTCCATGAGGAAGCCTGATGG + Intergenic
996549275 5:124712704-124712726 TTGTTCTTCTGGTAGCTGGAGGG - Intronic
998566537 5:143220815-143220837 CTGATCTTCTGGAAGCCTCAAGG + Intronic
1001027826 5:168239006-168239028 ATGTTCTCCAGGAAGCCTCAAGG + Intronic
1002857205 6:1048489-1048511 CTGTTCTTCCGGAAGGCCGATGG - Intergenic
1002869330 6:1151892-1151914 TTGCACTTCAGAAAGGCTGAGGG - Intergenic
1008143626 6:47862166-47862188 TTGGCCTTTAGGAGGCCTGATGG + Intergenic
1009876510 6:69512277-69512299 TTGTCTTTCAGGAATGCTGATGG - Intergenic
1010377926 6:75194720-75194742 CTGTGCTTTAGGAAGCCTGAGGG - Intronic
1011202139 6:84848235-84848257 TGGTTCTTCAAGTAGCTTGAAGG + Intergenic
1011295930 6:85826739-85826761 CTGTTCCCCAGGAACCCTGAAGG - Intergenic
1011739006 6:90340712-90340734 TTGAGTCTCAGGAAGCCTGAGGG + Intergenic
1012101823 6:95099092-95099114 TTGTTCTTCAGCACCCTTGAGGG + Intergenic
1014131285 6:117837206-117837228 TTGGCCTCCAGGAAGCATGAGGG - Intergenic
1014682821 6:124453871-124453893 TTTTTCTTAGGTAAGCCTGAAGG - Intronic
1015021411 6:128480243-128480265 TTGTTCTTCCAGATGCCTGCAGG + Intronic
1015339206 6:132078590-132078612 TTCTTCTTCTGGAATCATGAGGG + Intergenic
1016487246 6:144554838-144554860 ATATTCTTCAGCAAGCCCGACGG + Exonic
1018459412 6:163983647-163983669 TTGTTCTGCAAGGAACCTGAGGG - Intergenic
1018844205 6:167543833-167543855 TTGTTCTGCTGGAAGCCCCAGGG - Intergenic
1020127332 7:5540258-5540280 TAGTTCTTCAGGCACCCCGAGGG - Intronic
1022837875 7:34134189-34134211 TTGTTTTACAGTAAGCATGACGG + Intronic
1024598943 7:50962951-50962973 TTGCCCTGCAGGAAGCCTGGTGG + Intergenic
1024975622 7:55111471-55111493 ATTTTATTCAGGAAGCCTGGTGG - Intronic
1026932470 7:74231372-74231394 CGGTTCTTCTAGAAGCCTGAAGG - Intergenic
1029906722 7:104100373-104100395 TTCTTCTTCAGGAAGAGTGCAGG - Intergenic
1034880179 7:154757104-154757126 CTGTTCCTCAGGAGACCTGAGGG - Intronic
1034900047 7:154902540-154902562 TGGGTCTTCAGGAACCCAGAGGG - Intergenic
1037934847 8:22908723-22908745 TTCGTACTCAGGAAGCCTGAGGG + Intronic
1038060795 8:23909347-23909369 TTGTCCTTAAGGAAGACTTAAGG - Intergenic
1038220954 8:25607304-25607326 TTGTTAGTTAGGAAGCCTTATGG + Intergenic
1038307236 8:26415717-26415739 TTAATCTTCAGGAAGCCAGTGGG + Intronic
1043651429 8:82597819-82597841 TTGTTTTTCAGGAAGAGGGAAGG - Intergenic
1044621950 8:94199479-94199501 GTGTTTTTCTGGAAGACTGAAGG - Intronic
1045696396 8:104813344-104813366 ATGTACTTCAGAAAGCCTAATGG - Intronic
1049444030 8:142621874-142621896 TTGTGCTGCAGGAACCCTGAGGG + Intergenic
1050265615 9:3886605-3886627 ATTTTCTTCAGAATGCCTGAAGG - Intronic
1051108732 9:13610608-13610630 TTCCTCATCAGGATGCCTGAAGG - Intergenic
1053382890 9:37663300-37663322 TGGTTCTTCAGGAAGTCTTTTGG + Intronic
1054714653 9:68545534-68545556 TTGTTCTTCAGCCATCTTGAAGG + Intergenic
1056237061 9:84605153-84605175 TTGTTCTTTAGGAGGCCACATGG + Intergenic
1059723026 9:116980049-116980071 CCGTTCTCCAGGAAGCCTCATGG - Intronic
1061217797 9:129231756-129231778 TTGTTCTTCAGGGAGACTGAGGG - Intergenic
1061487004 9:130925087-130925109 TTGTTGGTCCAGAAGCCTGAGGG - Intronic
1185625429 X:1478029-1478051 CTGGTCTTCAGGAAGACAGATGG + Intronic
1186506111 X:10093831-10093853 TTTTTCTTTAGGAAACATGAAGG + Intronic
1188801821 X:34541618-34541640 TTGTTTTTTAGGAAAGCTGAAGG - Intergenic
1190383120 X:49858698-49858720 TTGTTCTTTTGGAAGCCCAAAGG + Intergenic
1190488328 X:50954038-50954060 TTTTTCTTCAGGAACCATGGAGG + Intergenic
1192180667 X:68913788-68913810 CTCTTCTTCAGGAAGCCTCCCGG - Intergenic
1193206529 X:78754843-78754865 TTTTTTTTCAGGAGGCCTGCTGG - Exonic
1194667442 X:96690944-96690966 TTGTGCTTCAGGGACTCTGAAGG + Intronic
1195851436 X:109286186-109286208 TTTTTCTTCAGGCAGCCAAATGG + Intergenic
1197666556 X:129230173-129230195 CTGTTCTTAAAGAAGCCTGAGGG - Intergenic
1198028748 X:132734727-132734749 CTGTTTTTCGGGAAGCCTGTTGG - Intronic
1198735303 X:139778154-139778176 TTTTTCTTTAGGAAGTCTAAAGG - Intronic