ID: 1108101576

View in Genome Browser
Species Human (GRCh38)
Location 13:46962458-46962480
Sequence CTCATGCAGAAGCTGATCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108101575_1108101576 7 Left 1108101575 13:46962428-46962450 CCGGATGATGACAATGTGCATGA No data
Right 1108101576 13:46962458-46962480 CTCATGCAGAAGCTGATCCATGG No data
1108101574_1108101576 8 Left 1108101574 13:46962427-46962449 CCCGGATGATGACAATGTGCATG No data
Right 1108101576 13:46962458-46962480 CTCATGCAGAAGCTGATCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108101576 Original CRISPR CTCATGCAGAAGCTGATCCA TGG Intergenic
No off target data available for this crispr