ID: 1108103536

View in Genome Browser
Species Human (GRCh38)
Location 13:46983752-46983774
Sequence CCTATCATGCACATGCTGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108103532_1108103536 7 Left 1108103532 13:46983722-46983744 CCCATATACTACAAAATCATTAA No data
Right 1108103536 13:46983752-46983774 CCTATCATGCACATGCTGTAAGG No data
1108103533_1108103536 6 Left 1108103533 13:46983723-46983745 CCATATACTACAAAATCATTAAA No data
Right 1108103536 13:46983752-46983774 CCTATCATGCACATGCTGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108103536 Original CRISPR CCTATCATGCACATGCTGTA AGG Intergenic
No off target data available for this crispr