ID: 1108114576

View in Genome Browser
Species Human (GRCh38)
Location 13:47112801-47112823
Sequence CCTATCTGGTCCTACATAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108114576_1108114581 3 Left 1108114576 13:47112801-47112823 CCTATTATGTAGGACCAGATAGG No data
Right 1108114581 13:47112827-47112849 GGACAGGCCAACCCTTTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108114576 Original CRISPR CCTATCTGGTCCTACATAAT AGG (reversed) Intergenic
No off target data available for this crispr