ID: 1108120464

View in Genome Browser
Species Human (GRCh38)
Location 13:47180422-47180444
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 382
Summary {0: 7, 1: 20, 2: 57, 3: 94, 4: 204}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108120464_1108120466 15 Left 1108120464 13:47180422-47180444 CCATAGGGTGACTATAGTTAACA 0: 7
1: 20
2: 57
3: 94
4: 204
Right 1108120466 13:47180460-47180482 TTTCCAAAAAGCCAGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108120464 Original CRISPR TGTTAACTATAGTCACCCTA TGG (reversed) Intergenic
900901234 1:5517491-5517513 TATTAACCATAGTCACCATGCGG - Intergenic
901009660 1:6192748-6192770 TGTTAACAATAGTCAACTTTTGG - Intronic
901272893 1:7966966-7966988 TGTTAACTATAGTCATTCTACGG + Intronic
903043541 1:20550007-20550029 TGTTAACTCTAGCAAGCCTAAGG + Intergenic
906931765 1:50177111-50177133 TGTTAACTATATTGATCCAAAGG + Exonic
907696551 1:56735895-56735917 TGTTAACTATAGTCATCCTATGG - Intronic
909009025 1:70311630-70311652 TGTTAACAATAGTCACCTCTGGG + Intronic
909157637 1:72098747-72098769 TATTAACTATAGACTTCCTACGG - Intronic
909922043 1:81394262-81394284 TGTTATTTATAGTCACTATATGG + Intronic
910813935 1:91268781-91268803 TTTTATCTGTAGTCAACCTATGG + Intronic
911685244 1:100768301-100768323 TGTTAACCATAGTCATCCTTTGG - Intergenic
911685741 1:100775195-100775217 TATTAACTATAGTCACCATGTGG - Intergenic
912859762 1:113203232-113203254 TATTGACTATACTCATCCTATGG + Intergenic
914915947 1:151819306-151819328 TGTTACCTACAATCACCCCATGG - Intronic
914963652 1:152231383-152231405 TGTTCACAATAGTCACAATATGG - Intergenic
915918603 1:159957287-159957309 TATTAACTGTAGTCACCATATGG - Intergenic
917569059 1:176245350-176245372 TTATGACTATAGTCACCCTGTGG + Intergenic
917992142 1:180391617-180391639 TGTTGATTATAGCCACCCTAAGG - Intronic
918452581 1:184673753-184673775 TGTTGACTATAGTCACCATATGG + Intergenic
918955877 1:191206074-191206096 TGTTAACTGTAGTCATCCTACGG + Intergenic
919056486 1:192576601-192576623 TCATAACTATAGTAACTCTAAGG + Intronic
919758848 1:201084228-201084250 TGTTAACTACTGTCACCACAGGG - Intronic
919870312 1:201815670-201815692 TATTAACTATAGTCACCATATGG - Intronic
921173989 1:212577464-212577486 TATTAACTATAGTCACTATGTGG + Intronic
922350507 1:224731390-224731412 TGTAAAATAGAGTCACCATATGG + Intronic
922990250 1:229901366-229901388 TGCTTGCTATAGTCACCTTAGGG - Intergenic
923043866 1:230339924-230339946 TATTAACTTTAGTCACCATGTGG - Intronic
923139096 1:231145705-231145727 TATTAACTATAGTCATTCTCTGG - Intergenic
924147885 1:241095826-241095848 TGTTAACTATAGTCATTCTACGG + Intronic
924313299 1:242769318-242769340 TGTTAACTATAGTCATCATGTGG - Intergenic
1062790049 10:297752-297774 TGTTAGTTATAGTCATCCTGCGG - Intronic
1063641267 10:7833018-7833040 TGTTGACTTTAGTCACCCTGTGG + Intronic
1064950497 10:20843881-20843903 AGTTAACCATATTCACCTTACGG + Intronic
1065412885 10:25449666-25449688 TATTAACTATAGTCACTATTTGG - Intronic
1066191815 10:33062891-33062913 TATTGACTATAATCAACCTATGG - Intergenic
1068701015 10:60019538-60019560 TGTTAACTATAGTCACCCTACGG - Intergenic
1068892714 10:62164454-62164476 TCTTAACTATAGTCACCCTATGG - Intergenic
1069045272 10:63736748-63736770 TTTCAAATAAAGTCACCCTAAGG + Intergenic
1073537463 10:104290833-104290855 TATTTACTATAGTCACCATGTGG - Intronic
1074644302 10:115428019-115428041 TGTTAACTATAGTGAGTCTTTGG + Intronic
1076008312 10:126965918-126965940 GGTTAACTATAGTCATCCTAAGG + Intronic
1077801369 11:5541737-5541759 TATTAACTATAGCCACCATAGGG - Intronic
1077828154 11:5832651-5832673 TCTTAACTATATTCATCATACGG - Intronic
1077988558 11:7380371-7380393 TATTGACTATAGTCACCCTATGG - Intronic
1079385387 11:19974415-19974437 TATTAACTAAAGTCACATTAGGG - Intronic
1079929873 11:26544525-26544547 TATTAACTATAGTCACCATGTGG - Intronic
1080390938 11:31845923-31845945 TGTTAACTATAGTCACCATATGG - Intronic
1082690669 11:56299968-56299990 TGTTAACTGTAGTCATTGTACGG + Intergenic
1086067952 11:82766121-82766143 TGTTTATTATAGTCACCCTACGG - Intergenic
1086636308 11:89090822-89090844 TATTAACTATAGTTACCTTATGG - Intergenic
1089019002 11:115192285-115192307 TGTTAACTATTAGCACCCAAGGG - Intronic
1090384712 11:126350671-126350693 TATTAACTATTGTCACCATGTGG + Intergenic
1090442780 11:126737919-126737941 TGTTAACTACAGTCACCCTGTGG + Intronic
1090870029 11:130736138-130736160 TATTAACTACAGTCACCTGATGG + Intergenic
1091559922 12:1604284-1604306 TGTTAACTATATTCGCCCTACGG - Intronic
1092118520 12:6026700-6026722 TGATAATTATAGTCACCCTGTGG - Intronic
1093583999 12:20816247-20816269 AATTGACTATAGTCACCCTGTGG + Intronic
1094420650 12:30267439-30267461 TATTGACTATAGTCACCCTGTGG - Intergenic
1094715345 12:33008618-33008640 CATTAACTATAGTCACCATGTGG + Intergenic
1096486753 12:51987787-51987809 TATTGACTATAGTCACCCTGTGG - Intronic
1096566244 12:52482736-52482758 TATTAACTATAGTCATCCTACGG + Intergenic
1096967444 12:55639446-55639468 TGTTACCTGAGGTCACCCTATGG - Intergenic
1097996836 12:65897279-65897301 TATTGACCATAGTCACCCTGTGG + Intronic
1098303405 12:69077663-69077685 TATTAAGTATAGTCACCATTGGG - Intergenic
1098742281 12:74188564-74188586 TATTAACTATAGTCACCATGAGG - Intergenic
1100204536 12:92334025-92334047 TATTAACTATAGTCCTCCTATGG + Intergenic
1103977128 12:124710354-124710376 TGTTAACTAAAATAACCCTCAGG - Intergenic
1105689195 13:22818904-22818926 TGTTAACCATAGTTACCCTCTGG + Intergenic
1106328287 13:28715642-28715664 TGTTAACTGTAGTCACCCTGTGG - Intronic
1106776208 13:33012418-33012440 TATTAACTATAGTCACCATGTGG - Intergenic
1107044877 13:35983550-35983572 TATTGACTATAGTCACCCTGTGG - Intronic
1107612693 13:42132327-42132349 TGTTAACTATAGTCATCCTACGG + Intronic
1107649695 13:42532468-42532490 TGTTAACTATAGTCACTCTATGG + Intergenic
1108120464 13:47180422-47180444 TGTTAACTATAGTCACCCTATGG - Intergenic
1108226015 13:48290089-48290111 TGTTAATTAAAGTCATCCTACGG + Intergenic
1108797855 13:54053967-54053989 TGTTAACTATATTCACCGTACGG - Intergenic
1109743601 13:66589319-66589341 TGTTACCTATAGTCATCGTAAGG - Intronic
1110024988 13:70525727-70525749 TATTAGCTATAGTCACCTTGCGG - Intergenic
1110594506 13:77304539-77304561 TGTTTATGATAGTCACCCTGTGG - Intronic
1111202522 13:84959201-84959223 TGTCAACTATAGTCACGACATGG + Intergenic
1111662954 13:91234266-91234288 CTTTCACTAGAGTCACCCTATGG - Intergenic
1111719436 13:91923081-91923103 ACTTAACTCTAGTTACCCTAAGG + Intronic
1112202167 13:97287558-97287580 TGTTAAGTACAGTCATCCTATGG + Intronic
1112831882 13:103462945-103462967 TGTTAACTACAGTTGCCCTAAGG - Intergenic
1112944123 13:104905087-104905109 TGTTGACTATAGTCACTCTGTGG + Intergenic
1114679190 14:24470015-24470037 TGTTAACTATAGTTATCCTATGG - Intergenic
1115520672 14:34230173-34230195 TGTTAACTACAGTCATCCTATGG - Intronic
1116320965 14:43462255-43462277 TGTTAACTATCATCACCTTATGG + Intergenic
1116631865 14:47346026-47346048 TGTTAACTATAGTCATTTTACGG - Intronic
1117043473 14:51789149-51789171 TGTTAACTCTAGTCATCCTGTGG + Intergenic
1117760035 14:59017008-59017030 TATTAACTATAGCCACCATATGG - Intergenic
1117865753 14:60147319-60147341 TATTAACTGTAGTCACCATGCGG - Exonic
1117917489 14:60693026-60693048 CGTTAATGATAGTCATCCTATGG + Intergenic
1117917566 14:60693642-60693664 CGTTAATGATAGTCATCCTATGG - Intergenic
1118200665 14:63669063-63669085 TTTTAACTATATTCACTCTACGG + Intergenic
1118378388 14:65197246-65197268 TATTGACTATAGTCACCCTGTGG + Intergenic
1118757729 14:68857142-68857164 TATTGACTATAGTCACCCTGTGG - Intergenic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1120580107 14:86236610-86236632 TGTTTACTGTAGTCACCCATTGG - Intergenic
1121298046 14:92846081-92846103 TGTGAACTATAGTCACCCTATGG + Intergenic
1121867293 14:97374404-97374426 TGTTGACTATGGTCAGGCTAAGG + Intergenic
1122755485 14:103975869-103975891 TGTCAACTGTAGTCACCCCACGG + Intronic
1123098712 14:105779411-105779433 TGTTAGTTATAGTCACCCTATGG + Intergenic
1125217848 15:37298040-37298062 TTTTAAGTATAGCCATCCTATGG + Intergenic
1127058811 15:55161163-55161185 TATTAACTATAGTCACCTTGCGG - Intergenic
1128487169 15:68104627-68104649 TATTAACTACAGTCTCCCTCTGG - Intronic
1129597729 15:76977722-76977744 TGTTAATTATAGTCATCCTAGGG + Intergenic
1130634925 15:85609176-85609198 TGCTAACTATAGTCACCCTTCGG + Intronic
1133903857 16:10002847-10002869 TGTGAACGAGAGTCACCCAATGG + Intronic
1135297543 16:21295593-21295615 TGTTAACTATAGTAATACAATGG + Intronic
1135849357 16:25949260-25949282 TCATGACTATAGTCATCCTATGG + Intronic
1136489196 16:30594421-30594443 TGTTAACTATAGTCATCCTACGG - Intergenic
1137256715 16:46781155-46781177 TATTAACTATAGTCATCCTACGG + Intronic
1137271731 16:46906773-46906795 TGTTAATTATATTGACCCTGTGG + Intronic
1137870063 16:51941246-51941268 TGTTAATTATAGTCACCCTATGG - Intergenic
1138912782 16:61422434-61422456 TATTGACTATAGTCACCCTACGG + Intergenic
1138934418 16:61700826-61700848 TGTTTATTATGGCCACCCTATGG - Intronic
1139189956 16:64850944-64850966 TGTTAACTATAGTCACCCTATGG - Intergenic
1139519334 16:67471560-67471582 TGTTAAATACAGTCACCCTATGG + Intronic
1140264681 16:73410078-73410100 TGTTGACTTTAGTCACCTTATGG - Intergenic
1141177276 16:81729458-81729480 TGTTAACTGTCCTCACCCTGGGG + Intergenic
1143844683 17:9765185-9765207 TGTTAACTTTAAGCAACCTAAGG + Intergenic
1144333356 17:14245413-14245435 TGTGAACTGTAGTCAGCCAATGG + Intergenic
1147532980 17:41297944-41297966 TGTTCACTATAGCATCCCTATGG - Intergenic
1151034397 17:70781289-70781311 TGTTAACTATATTCACCCTATGG - Intergenic
1151394761 17:73815320-73815342 TGTTAACTGTAGTCATCCTATGG - Intergenic
1153088933 18:1321537-1321559 TGTAGACTATAGTTACCCTGTGG - Intergenic
1153169271 18:2296404-2296426 TGTTAACTATAGTCATTCTATGG - Intergenic
1155621129 18:27781439-27781461 TTTTAACTATTGTCACTCCATGG - Intergenic
1156160007 18:34348116-34348138 CCTTAACTATATTTACCCTATGG + Intergenic
1157685931 18:49642460-49642482 TATTAACTGTAGTCACCATGTGG + Intergenic
1157879907 18:51311650-51311672 TGTTGATTGTAGTCACCCTATGG - Intergenic
1158315732 18:56209853-56209875 TGTTAACTTAGGTTACCCTATGG - Intergenic
1159297092 18:66506258-66506280 TATTAGCTACAATCACCCTACGG - Intronic
1159297191 18:66508325-66508347 TATTAACTATAGTTACCATGTGG - Intronic
1159520896 18:69521753-69521775 TATTACCTATAGTCACTCTACGG - Intronic
1159525247 18:69580731-69580753 TGTTAATTATAGTCACCTTATGG + Intronic
1166285474 19:41824104-41824126 TGTTAAATATAGTCATCCTACGG - Intergenic
1167788261 19:51653627-51653649 TTTTGACTATAATCACCCTGTGG - Intergenic
1168184776 19:54692822-54692844 TGTTAACTATAGTCACCCTACGG - Intronic
925455016 2:4008661-4008683 TGTTAACACTAGTCACCCAATGG + Intergenic
926371747 2:12185591-12185613 TATTAACTGTAGTCACCATGTGG - Intergenic
927257777 2:21055336-21055358 TGTTACCTGTAGTCATCCTAAGG + Intergenic
928787003 2:34900207-34900229 TATTAACTATAGTCTTCATATGG + Intergenic
929326457 2:40617493-40617515 TATTGACTATAGTCACCCTATGG + Intergenic
929638772 2:43553794-43553816 TTTAAATTATAGTCATCCTATGG + Intronic
930772752 2:55144174-55144196 TGTTAACTATAGTCACGATGTGG - Intergenic
931436019 2:62247377-62247399 TGTTAACTATAATCACCCTAGGG + Intergenic
931698001 2:64886339-64886361 TTTTAATTATAGCCATCCTAAGG + Intergenic
931736986 2:65204688-65204710 TATTAACCATGGTCACCATATGG - Intergenic
932704991 2:74017289-74017311 TGTGAATTATAGTTGCCCTATGG + Intronic
932998014 2:76881033-76881055 TGTCAACTATAGCCATCCTACGG - Intronic
933647567 2:84824942-84824964 TGGTGACTATAGTCACCTTTAGG - Intronic
935017233 2:99195493-99195515 TGTTAACTGTAGTTATCCTGCGG + Intronic
935136468 2:100307672-100307694 TATTAACTGTAGTCAACATATGG - Intronic
935461332 2:103338464-103338486 TGTTAACTATAGTCACAATAGGG + Intergenic
936891945 2:117381227-117381249 TGTTAACTACAGTCATCCTACGG + Intergenic
937225179 2:120364595-120364617 TGTTAACTGTGGGCACCTTATGG - Intergenic
938074454 2:128324262-128324284 TGACAACAATAATCACCCTATGG + Intergenic
938321020 2:130363956-130363978 TTTTAATTATAGCCATCCTAGGG + Intronic
938831935 2:135059676-135059698 TGTTAACTAAAGTCACTCTAAGG + Intronic
938957491 2:136312455-136312477 TGCTAACTATAGTCACTCTATGG + Intergenic
939283893 2:140103132-140103154 TGTTAACTATAATTTCTCTAGGG + Intergenic
940570232 2:155422779-155422801 TGTTAACTATACTCATCCTACGG + Intergenic
940990955 2:160095881-160095903 TGTTCACTGTAGTCACCCTGTGG - Intergenic
941018475 2:160383690-160383712 TGTTAACTATAGTCATTCTATGG + Intronic
941037952 2:160588258-160588280 TTTTAACTATAGTCACTCTGTGG + Intergenic
941058859 2:160822181-160822203 TGTTGATTATAGTCACCCTGTGG + Intergenic
942335650 2:174882187-174882209 TGTTTACTATAGTAACACTCTGG - Intronic
942979322 2:182060489-182060511 TGTTAACTGTAGTTATCCTGGGG - Intronic
943338683 2:186650528-186650550 TATTAACTATAGTCAATCTACGG + Intronic
944611032 2:201408042-201408064 TGCCAACTATAGCCACCCTATGG + Intronic
945230849 2:207587885-207587907 ATTTAACCATATTCACCCTATGG - Intronic
947700065 2:232226249-232226271 TGTTAATCATAGTCAGCCTTAGG + Intronic
947997516 2:234541254-234541276 TATTAACTATGGTCACCATGTGG - Intergenic
1169895032 20:10494922-10494944 TAATAACTATAGTCACCATGAGG - Intronic
1170048078 20:12108802-12108824 TGTTAACTATAGGCATTCTGTGG - Intergenic
1171112057 20:22493258-22493280 TGTTGACTGTACTCATCCTACGG - Intergenic
1171374156 20:24680781-24680803 TGTTCACTGTTGTCAGCCTAGGG + Intergenic
1173299282 20:41786774-41786796 TGTTAACCATAACCACCCTCTGG + Intergenic
1177862390 21:26469676-26469698 TGTTGACTATAGTCATCCAGTGG + Intronic
1177911178 21:27034378-27034400 TGTTAACTGTAGTCATCCTCTGG + Intergenic
1177958610 21:27633034-27633056 TGTTAACTATAGTCATTTTATGG - Intergenic
1179152284 21:38819324-38819346 TGTGTAGTATAGTTACCCTAAGG + Intronic
1180569954 22:16705115-16705137 TGATAATTATAGTCACCCTGTGG - Intergenic
1181391247 22:22583181-22583203 TGTTAACCATAGTCACATTGCGG + Intergenic
1181848330 22:25731216-25731238 TGTTGTCTATAGTCACTTTATGG + Intergenic
1182065193 22:27426093-27426115 TATTAACCATAGTCACCTTGTGG - Intergenic
1183025283 22:35060965-35060987 TATTAACTATAGTCACCATGTGG - Intergenic
949315737 3:2752662-2752684 TCTTAACTGTAGTCACCCTGTGG + Intronic
949843311 3:8343799-8343821 TTTTAACTATAATCATACTATGG + Intergenic
950225379 3:11229209-11229231 TGTTTACTATTGTCTCCTTATGG - Intronic
951285125 3:20801548-20801570 TTTTAACTATAGTCATACTCTGG - Intergenic
951550058 3:23868273-23868295 AAGTAACTATGGTCACCCTAGGG - Intronic
951652914 3:24972047-24972069 TATTAACTATATTCAGCCTATGG + Intergenic
952715700 3:36478290-36478312 AGTTAACAATAGTCACAATAGGG - Intronic
952944208 3:38466293-38466315 TGCTAACTACAAGCACCCTACGG - Intronic
953280825 3:41554647-41554669 TGTTAACTGTAGGCACCATATGG - Intronic
954805691 3:53218728-53218750 TGTTAATTATGGTCAGCCTACGG - Intergenic
956543229 3:70367648-70367670 TGTTCACAATAGTCAAGCTATGG - Intergenic
958100669 3:89005453-89005475 TTTTGACTATAGTTACCCTGCGG + Intergenic
958125877 3:89354070-89354092 TGTTAACTATATTCCCCCAAGGG + Intronic
958439717 3:94141278-94141300 TGTTAACTATAGTCATCCTATGG - Intergenic
958599346 3:96274960-96274982 TATTAGCTATATTCACCATACGG - Intergenic
960261231 3:115570847-115570869 TGTTAACTATAGTCATCTTAAGG - Intergenic
961953691 3:130777381-130777403 TGTTAACTATAGTTACCCTACGG - Intergenic
962703640 3:138022831-138022853 TGTTAACTACTGTCATCCCATGG + Intronic
963556805 3:146801418-146801440 TGGTAACCATAGTCACCATAGGG + Intergenic
964240150 3:154583260-154583282 TGTTATTTATAGTCATCTTAAGG - Intergenic
964533835 3:157697833-157697855 AGTAAACTATAGACACACTATGG + Intergenic
965086207 3:164101719-164101741 TGTTAATCATCGTCATCCTACGG + Intergenic
965285176 3:166810730-166810752 CATTGACGATAGTCACCCTATGG + Intergenic
968348506 3:198032173-198032195 TGTTGACTGTGGTCTCCCTATGG + Intronic
968464243 4:742577-742599 TGTGAACTAAGGTCACCCTTAGG + Intronic
970074964 4:12207711-12207733 TGTTAATTATAGTCACAAGAAGG + Intergenic
970173804 4:13316114-13316136 TGTTAACTATAGTCACTCCAAGG + Intergenic
970918032 4:21358569-21358591 TGTTCAATCTGGTCACCCTATGG - Intronic
972236643 4:37142256-37142278 TATTAACTGTAATCACCATATGG + Intergenic
973656535 4:53053988-53054010 AATAAACTATAGTCACCCTCTGG + Intronic
974783757 4:66590234-66590256 TGTTAATTACAGTCACCTTATGG + Intergenic
975507213 4:75150718-75150740 TGTTAAGTATAATTTCCCTACGG + Intergenic
977782907 4:100999260-100999282 TGTTAATTATAGTCATCCAATGG + Intergenic
978081588 4:104599600-104599622 TATTAACTCTAGTTACCATATGG + Intergenic
980239259 4:130152329-130152351 TGTTAACTATAGTCATCTTATGG - Intergenic
980420494 4:132553475-132553497 AGTTAACCATAATCACCCTGTGG + Intergenic
980624159 4:135350617-135350639 TGTTAACTGTGGTGAACCTAGGG - Intergenic
980664816 4:135917668-135917690 TGTCAACTATAGTCATCCTACGG - Intergenic
981180851 4:141742313-141742335 CATTAACCATAGTCACCATACGG - Intergenic
983100278 4:163617320-163617342 TGTTAGCTATATTCACTTTATGG - Intronic
983156040 4:164350441-164350463 TATTAAATATATTCATCCTATGG - Intronic
983497917 4:168464759-168464781 TGTTAATTATATCCACCCTATGG + Intronic
983857051 4:172659425-172659447 TGTTAACTGTAGTCGTCCTATGG + Intronic
983927188 4:173414844-173414866 TGTCAACTATTCACACCCTAGGG - Intergenic
983975321 4:173926844-173926866 TCCTAATTATAGTCACCCTGTGG - Intergenic
984339006 4:178429730-178429752 TTTTGACTATTGTCAGCCTATGG - Intergenic
986160047 5:5219284-5219306 TGTTAACTATCGTCACCCTATGG + Intronic
987413668 5:17640207-17640229 TGTTAACTATAGTCACCATGTGG + Intergenic
987971098 5:24945634-24945656 TGTTAACTATAGTCACATTACGG + Intergenic
988111585 5:26829461-26829483 TGTCAACTGTAGTCACCCTATGG - Intergenic
988258708 5:28854151-28854173 TATTAACTATAGTCACCCTGTGG - Intergenic
988310061 5:29544791-29544813 TATTAACTATAGTCACCATGCGG + Intergenic
988394673 5:30681278-30681300 TATTAACTATAGTGACTATATGG - Intergenic
988607740 5:32694750-32694772 TGTTGACTGTAGCCACCCTGTGG + Intronic
989210915 5:38858169-38858191 TGTTAGCTATAATCACCCTGTGG + Intronic
990783031 5:59387849-59387871 TGTTAACTATAGTCACCCTGAGG + Intronic
991602164 5:68363981-68364003 AGTTAACCATATTCACCCTATGG - Intergenic
993514798 5:88818036-88818058 TATTAACTGTAGTCATCCTTTGG - Intronic
993770831 5:91924109-91924131 TATTATCTATATTCACCATAAGG - Intergenic
994296134 5:98090551-98090573 TGTTAGCTATGGTCACCATGTGG + Intergenic
995192331 5:109330814-109330836 TGGTAGCTAAAGTCACCTTAGGG + Intergenic
995286415 5:110393991-110394013 TGTTGACTGTAGTCACCATGTGG + Intronic
995497973 5:112768696-112768718 TGTTAACTGTGCTCATCCTATGG + Intronic
995700615 5:114930740-114930762 TGATAGCTATAGTCAGCATAAGG - Intergenic
996610129 5:125368787-125368809 TATTGACTATAGTCACCCAGTGG + Intergenic
997593261 5:135088632-135088654 TATTAATTATAGTCACCTTATGG + Intronic
998744736 5:145245546-145245568 AGTTAACTGCAGGCACCCTAGGG - Intergenic
1000399352 5:160809592-160809614 TGTTAACAATAGTCATCTTACGG + Intronic
1000573112 5:162939443-162939465 TGTTCACTATAGTCCCCCTACGG - Intergenic
1002839695 6:895079-895101 TGTTAACTGCAGTCATCCTATGG - Intergenic
1002982241 6:2149775-2149797 AGTTAAATATAGTCACCGTTGGG - Intronic
1004238436 6:13896583-13896605 TATTAACTGTAGTCATCCTATGG + Intergenic
1005530239 6:26697263-26697285 TATTAACTGTAGTCACCATACGG - Intergenic
1005540557 6:26804383-26804405 TATTAACTGTAGTCACCATACGG + Intergenic
1005776124 6:29132301-29132323 TGTTAACAACAGTCACGCTATGG - Intergenic
1006074496 6:31522487-31522509 TATTAAGTTTAGTCACCATAAGG - Intergenic
1007456678 6:41983532-41983554 TATTAACTATAATCACCATGTGG + Intronic
1008036167 6:46747476-46747498 TGTAGACTATAGGCAGCCTAGGG - Intronic
1008410349 6:51171453-51171475 TGTTAACTATAGACATCCTTGGG - Intergenic
1009011371 6:57846480-57846502 TATTAACTGTAGTCACCATACGG + Intergenic
1009405850 6:63311798-63311820 TATTAACTGTAGTCACCATGTGG + Intronic
1009568515 6:65347776-65347798 TGTTGCCTGTAGTCACCCTGTGG + Intronic
1009668567 6:66715049-66715071 CGTTAACTATAATCACACCACGG - Intergenic
1010632479 6:78215063-78215085 TTTTAACTATAGTCACCCTATGG + Intergenic
1011112102 6:83850038-83850060 TGTAAAATACAGTCACCCCAAGG - Intergenic
1011176296 6:84564560-84564582 TGTTGATTATAGTCACTCTGTGG - Intergenic
1011220154 6:85046495-85046517 TGCTAACTATGGTGACCATAAGG - Intergenic
1011377874 6:86709689-86709711 TGTCAATTATAAACACCCTAAGG + Intergenic
1012230653 6:96757357-96757379 TATTAACTATAGTCACCATGTGG - Intergenic
1014345299 6:120262791-120262813 TATTAACTATAGCCACCATGTGG - Intergenic
1014353327 6:120371973-120371995 TGTTAACTATAGGCACAATGTGG - Intergenic
1015002451 6:128234950-128234972 TGTTAACTATAGTCACCCTATGG - Intronic
1016133345 6:140505809-140505831 TGTTAGCTCTAGTGATCCTATGG + Intergenic
1016212871 6:141561878-141561900 TGCTGACTATAGTCACCCTGCGG + Intergenic
1016624522 6:146150610-146150632 TGTTAACTATAGTCACCCTGTGG + Intronic
1016642953 6:146371519-146371541 TATTGACTATAGTCACCCTACGG + Intronic
1017078178 6:150639449-150639471 TGTTAATTACAGTCATCCTCTGG + Intronic
1018541460 6:164884620-164884642 TGTTAACTCTAGCTATCCTATGG + Intergenic
1020053118 7:5096292-5096314 TGTCAATTATAGTCACCCTATGG + Intergenic
1020442536 7:8233694-8233716 TGTTAACAATAGGCACCATGGGG - Intronic
1020455185 7:8364871-8364893 TGTTGTATATTGTCACCCTAGGG + Intergenic
1021117783 7:16763093-16763115 TGTTAAATTTAGTAACGCTAAGG + Intronic
1021831270 7:24613641-24613663 TGTCAACTATGGTCACCTTATGG + Intronic
1022124715 7:27344550-27344572 TATTAACTATAGTCACCCTGTGG + Intergenic
1023137472 7:37066577-37066599 TATTAACTATAGTCATCCTACGG - Intronic
1023152600 7:37215806-37215828 TGTTAATTATAGTTCCCCAAAGG - Intronic
1023462278 7:40411709-40411731 TGTTAACTATAGTCAACCAACGG - Intronic
1023940095 7:44763704-44763726 TGCTAACGATGGTCACCCTTGGG - Intronic
1024108090 7:46113822-46113844 TATTGACTATAGTCACCCTGTGG + Intergenic
1024565650 7:50677783-50677805 TGTTAAGTATAGTCAGTCTTGGG + Intronic
1024923210 7:54582988-54583010 TGCTAACTATAGTTATCCTATGG - Intergenic
1026395918 7:69954232-69954254 TGTTAACTATAGTCACTATGTGG - Intronic
1028183997 7:87759417-87759439 TGTTGACTACAGTCACCCATTGG - Intronic
1028205943 7:88017208-88017230 CGTTAAATATATTCACCCTACGG - Intronic
1028338475 7:89687929-89687951 TGTTAACTATAGTCAGCTCGTGG + Intergenic
1029088377 7:98029137-98029159 TATTGACTGTAGTCACCCTGTGG + Intergenic
1030035957 7:105408565-105408587 TGTTAACTGTAATAACCCTGTGG - Intergenic
1030672626 7:112353869-112353891 TGTTACCTATAGTCATCCTACGG + Intergenic
1031559513 7:123221240-123221262 TGTTGACTATAGTCACTCTGTGG + Intergenic
1031584658 7:123519736-123519758 TGTTAACTATAGTCACCGTACGG - Intronic
1033932614 7:146542997-146543019 TATTAACTATAGTCATCATGTGG - Intronic
1035927024 8:3739342-3739364 GGTTAACTACAGTCACACTGTGG - Intronic
1036089057 8:5645329-5645351 TGTTAACTATAGCCATCTTACGG - Intergenic
1038645418 8:29357586-29357608 TGTTAACTATATTCACCCTACGG + Intergenic
1039108685 8:34018490-34018512 TGTTAATTATAGTTATCATATGG + Intergenic
1039318482 8:36400149-36400171 TGTTAACTGTAGTCACCCTATGG - Intergenic
1039360099 8:36866807-36866829 TATTAACTATAGTCACTTTACGG - Intronic
1039687282 8:39817424-39817446 TGTTAACTATAGTCACCCTATGG - Intronic
1040061296 8:43105234-43105256 TGTTAATTATAGTCATCCTATGG + Intronic
1040758708 8:50811894-50811916 TATAAACTATAGTCACCAGAAGG - Intergenic
1042475324 8:69242420-69242442 TATTAACTGTAGTCAGTCTACGG - Intergenic
1042487937 8:69367160-69367182 TGTTAAGCAAAGCCACCCTAGGG - Intergenic
1042938646 8:74085948-74085970 TGTTAACTAGAGTCACCCTGCGG + Intergenic
1043015429 8:74934280-74934302 TATTGACTATAGTCATCCTGTGG + Intergenic
1043115400 8:76246876-76246898 TGTTAACTATATTCACTGTATGG - Intergenic
1043384913 8:79738894-79738916 TGTTGACCATAGTCACCCTGTGG + Intergenic
1045024885 8:98077144-98077166 GGATAACAATAGTCCCCCTATGG + Intronic
1045932236 8:107640860-107640882 TCCAAACTATAGTCACCCTAAGG + Intergenic
1046223461 8:111245720-111245742 TGTTAAATATACTGACCCCAAGG - Intergenic
1046889879 8:119411211-119411233 TGTTGACTATAGTCACCCTATGG + Intergenic
1050098770 9:2096141-2096163 AGTTAATGGTAGTCACCCTAGGG + Intronic
1050201987 9:3155388-3155410 CGTTAACTATTGTCATCCTATGG + Intergenic
1051448352 9:17165918-17165940 TGTTAACTATAGAGACCTTTGGG + Intronic
1053623230 9:39842149-39842171 TAATAAATATAGTCACCCTGTGG - Intergenic
1053881639 9:42601079-42601101 TAATAAATATAGTCACCCTGTGG + Intergenic
1055082896 9:72284621-72284643 TTTTAATTATAGTCATCCTAGGG + Intergenic
1055484443 9:76743809-76743831 TGTTAACTTTAGTTACCTTGGGG + Intronic
1055727558 9:79247751-79247773 TATTAACAATAGTCACCATGCGG - Intergenic
1057094850 9:92296568-92296590 TGTTAACCATTATGACCCTAGGG - Intergenic
1058213128 9:102198417-102198439 TATTAACTATGGCCACCATATGG - Intergenic
1058973778 9:110107184-110107206 TGTTAACTACAGTTATTCTATGG - Intronic
1059614645 9:115935754-115935776 TTTTAACTATAGTCACCGTATGG + Intergenic
1060164251 9:121396169-121396191 TGTTAATTATAGTCATCCTATGG + Intergenic
1061465106 9:130772092-130772114 TGTTAACATTATTCTCCCTAAGG - Intronic
1061837299 9:133337763-133337785 TGCCAACTATAGTGACACTAAGG + Intergenic
1187654065 X:21449369-21449391 TGTTACCCACAGTCAACCTAAGG - Intronic
1187818045 X:23255016-23255038 TGTTGAATATAGTAACCCTACGG - Intergenic
1188266564 X:28083493-28083515 TGTTAACTATAGTTGCCCCATGG - Intergenic
1188287638 X:28347622-28347644 TGTTAACTATAGTCACCATGAGG + Intergenic
1188500568 X:30821255-30821277 TGTTAACTATGGTCACCAGGTGG - Intergenic
1188662099 X:32773444-32773466 TGGTAACTATAATCACTCTAGGG + Intronic
1188715342 X:33453324-33453346 TATTTACTATAGTTATCCTATGG - Intergenic
1189541191 X:41991724-41991746 TGTTAGCTATAGTTGCCCTACGG - Intergenic
1190898379 X:54643671-54643693 TGTTAACTATAGTCACCCTATGG + Intergenic
1190992083 X:55562448-55562470 TATTAACTATTGTCACCATGTGG + Intergenic
1191218538 X:57959966-57959988 TGTTAATTATAGTTACCCTATGG - Intergenic
1192475793 X:71441612-71441634 TATTAACTATAGTCATTCTACGG + Intronic
1193057144 X:77165187-77165209 TATTTACTATATTCACCCTGTGG + Intergenic
1193057745 X:77172523-77172545 TGTTAACTGTAGCCATCCTATGG - Intergenic
1193211788 X:78815309-78815331 CCTTAACTATAGTCACCTTCCGG - Intergenic
1193609647 X:83614006-83614028 TGTTAACTATAGTCATCTTAGGG - Intergenic
1193822055 X:86177174-86177196 TGTTGACTGTAGTCACCCTGTGG + Intronic
1194232829 X:91345736-91345758 TGTTAGCTATAGTCATCCTATGG + Intergenic
1194363295 X:92982000-92982022 TATTGACTATAGTCACCTTGTGG - Intergenic
1195857631 X:109348221-109348243 TTTTAACTACAGTCCTCCTATGG - Intergenic
1196267751 X:113671803-113671825 TATTGACTATAGTTACCCTGTGG + Intergenic
1196384714 X:115137095-115137117 TATTAACTATAGTCAACCTATGG + Intronic
1196937527 X:120744395-120744417 TATTGACTATAGTCACCCCGTGG + Intergenic
1197354887 X:125426138-125426160 TATTGACTACAGTCACCCTGTGG - Intergenic
1197538116 X:127717105-127717127 TATTAACCGTAGTCACCATAAGG - Intergenic
1198453106 X:136787531-136787553 TGTTAAACATAGTTACCATATGG + Intergenic
1198632467 X:138656026-138656048 TGTTCACTGTAGTATCCCTAGGG - Intronic
1198985685 X:142450176-142450198 TGTTAGCTGGAGTCACCATACGG + Intergenic
1199102204 X:143815626-143815648 TTTTGACTATAGTCACCTTGTGG - Intergenic
1199866013 X:151850882-151850904 TATTAACTATAGTCACCATACGG - Intergenic
1200335252 X:155344074-155344096 TATTAACTATAGTCATCACATGG + Intergenic
1200351216 X:155497147-155497169 TATTAACTATAGTCATCACATGG - Intronic
1200671536 Y:6098249-6098271 TATTGACTATAGTCACCTTGTGG - Intergenic
1200738019 Y:6821468-6821490 TGTTATCTACAGTCACCGTAAGG + Intergenic
1201399626 Y:13591273-13591295 TATTAAATATAGACACCCCACGG + Intergenic
1201725616 Y:17147480-17147502 GGTTGACTATAGTCACCCTGAGG - Intergenic
1202105969 Y:21366016-21366038 TGGTAACCATAGTCACCATAGGG - Intergenic
1202201666 Y:22357899-22357921 TGGTAACCATAGTTACCATAGGG + Intronic