ID: 1108123232

View in Genome Browser
Species Human (GRCh38)
Location 13:47212510-47212532
Sequence CTGGTGGGTTATGGTGTTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108123228_1108123232 -7 Left 1108123228 13:47212494-47212516 CCTCTCAGGAGGAGTTCTGGTGG No data
Right 1108123232 13:47212510-47212532 CTGGTGGGTTATGGTGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108123232 Original CRISPR CTGGTGGGTTATGGTGTTCT TGG Intergenic
No off target data available for this crispr