ID: 1108124424

View in Genome Browser
Species Human (GRCh38)
Location 13:47225626-47225648
Sequence TATACCAACATGCACACAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108124424_1108124427 5 Left 1108124424 13:47225626-47225648 CCCACTGTGTGCATGTTGGTATA No data
Right 1108124427 13:47225654-47225676 CATTGTTCCACAGCTTTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108124424 Original CRISPR TATACCAACATGCACACAGT GGG (reversed) Intergenic
No off target data available for this crispr