ID: 1108124427

View in Genome Browser
Species Human (GRCh38)
Location 13:47225654-47225676
Sequence CATTGTTCCACAGCTTTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108124424_1108124427 5 Left 1108124424 13:47225626-47225648 CCCACTGTGTGCATGTTGGTATA No data
Right 1108124427 13:47225654-47225676 CATTGTTCCACAGCTTTCTAAGG No data
1108124425_1108124427 4 Left 1108124425 13:47225627-47225649 CCACTGTGTGCATGTTGGTATAC No data
Right 1108124427 13:47225654-47225676 CATTGTTCCACAGCTTTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108124427 Original CRISPR CATTGTTCCACAGCTTTCTA AGG Intergenic
No off target data available for this crispr