ID: 1108127148

View in Genome Browser
Species Human (GRCh38)
Location 13:47256851-47256873
Sequence CCATTTCCACACCCCTGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108127145_1108127148 0 Left 1108127145 13:47256828-47256850 CCCATCATTCATTCTGCTCATGT No data
Right 1108127148 13:47256851-47256873 CCATTTCCACACCCCTGAAGAGG No data
1108127146_1108127148 -1 Left 1108127146 13:47256829-47256851 CCATCATTCATTCTGCTCATGTC No data
Right 1108127148 13:47256851-47256873 CCATTTCCACACCCCTGAAGAGG No data
1108127144_1108127148 11 Left 1108127144 13:47256817-47256839 CCTACAATTTTCCCATCATTCAT No data
Right 1108127148 13:47256851-47256873 CCATTTCCACACCCCTGAAGAGG No data
1108127142_1108127148 27 Left 1108127142 13:47256801-47256823 CCCAGTTATTGTTCATCCTACAA No data
Right 1108127148 13:47256851-47256873 CCATTTCCACACCCCTGAAGAGG No data
1108127143_1108127148 26 Left 1108127143 13:47256802-47256824 CCAGTTATTGTTCATCCTACAAT No data
Right 1108127148 13:47256851-47256873 CCATTTCCACACCCCTGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108127148 Original CRISPR CCATTTCCACACCCCTGAAG AGG Intergenic
No off target data available for this crispr