ID: 1108128132

View in Genome Browser
Species Human (GRCh38)
Location 13:47267406-47267428
Sequence AATTGAGAAAAGACAGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108128128_1108128132 25 Left 1108128128 13:47267358-47267380 CCTCACTACCAAACTGCCAGGAA No data
Right 1108128132 13:47267406-47267428 AATTGAGAAAAGACAGAGCTGGG No data
1108128129_1108128132 17 Left 1108128129 13:47267366-47267388 CCAAACTGCCAGGAAGAGTCACA No data
Right 1108128132 13:47267406-47267428 AATTGAGAAAAGACAGAGCTGGG No data
1108128130_1108128132 9 Left 1108128130 13:47267374-47267396 CCAGGAAGAGTCACATGAAATTT No data
Right 1108128132 13:47267406-47267428 AATTGAGAAAAGACAGAGCTGGG No data
1108128125_1108128132 30 Left 1108128125 13:47267353-47267375 CCCAACCTCACTACCAAACTGCC No data
Right 1108128132 13:47267406-47267428 AATTGAGAAAAGACAGAGCTGGG No data
1108128126_1108128132 29 Left 1108128126 13:47267354-47267376 CCAACCTCACTACCAAACTGCCA No data
Right 1108128132 13:47267406-47267428 AATTGAGAAAAGACAGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108128132 Original CRISPR AATTGAGAAAAGACAGAGCT GGG Intergenic
No off target data available for this crispr