ID: 1108133009

View in Genome Browser
Species Human (GRCh38)
Location 13:47323595-47323617
Sequence CCATGAGGGCATAACCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108133005_1108133009 -5 Left 1108133005 13:47323577-47323599 CCAGCTATATGGTAATTTCCATG No data
Right 1108133009 13:47323595-47323617 CCATGAGGGCATAACCCTCCAGG No data
1108133003_1108133009 -3 Left 1108133003 13:47323575-47323597 CCCCAGCTATATGGTAATTTCCA No data
Right 1108133009 13:47323595-47323617 CCATGAGGGCATAACCCTCCAGG No data
1108133004_1108133009 -4 Left 1108133004 13:47323576-47323598 CCCAGCTATATGGTAATTTCCAT No data
Right 1108133009 13:47323595-47323617 CCATGAGGGCATAACCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108133009 Original CRISPR CCATGAGGGCATAACCCTCC AGG Intergenic
No off target data available for this crispr