ID: 1108141650

View in Genome Browser
Species Human (GRCh38)
Location 13:47428922-47428944
Sequence CAGGCTGAAGAGCAGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108141644_1108141650 -1 Left 1108141644 13:47428900-47428922 CCGATGGTTTCCAGAACATGTCC No data
Right 1108141650 13:47428922-47428944 CAGGCTGAAGAGCAGGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108141650 Original CRISPR CAGGCTGAAGAGCAGGAAGG AGG Intergenic
No off target data available for this crispr