ID: 1108141650 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:47428922-47428944 |
| Sequence | CAGGCTGAAGAGCAGGAAGG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1108141644_1108141650 | -1 | Left | 1108141644 | 13:47428900-47428922 | CCGATGGTTTCCAGAACATGTCC | No data | ||
| Right | 1108141650 | 13:47428922-47428944 | CAGGCTGAAGAGCAGGAAGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1108141650 | Original CRISPR | CAGGCTGAAGAGCAGGAAGG AGG | Intergenic | ||
| No off target data available for this crispr | |||||