ID: 1108148956

View in Genome Browser
Species Human (GRCh38)
Location 13:47511437-47511459
Sequence AGGTCACAGACGAGGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108148952_1108148956 30 Left 1108148952 13:47511384-47511406 CCAATTTTATGCATTTGGACATC No data
Right 1108148956 13:47511437-47511459 AGGTCACAGACGAGGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108148956 Original CRISPR AGGTCACAGACGAGGCAGAG AGG Intergenic
No off target data available for this crispr