ID: 1108151447

View in Genome Browser
Species Human (GRCh38)
Location 13:47539988-47540010
Sequence GCTCTTGGTGTTTTACATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108151447_1108151453 29 Left 1108151447 13:47539988-47540010 CCAGGATGTAAAACACCAAGAGC No data
Right 1108151453 13:47540040-47540062 TGAAAATGATGCATCCCTGTAGG No data
1108151447_1108151451 5 Left 1108151447 13:47539988-47540010 CCAGGATGTAAAACACCAAGAGC No data
Right 1108151451 13:47540016-47540038 CTAATGTAAACAATGAACTTTGG No data
1108151447_1108151452 6 Left 1108151447 13:47539988-47540010 CCAGGATGTAAAACACCAAGAGC No data
Right 1108151452 13:47540017-47540039 TAATGTAAACAATGAACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108151447 Original CRISPR GCTCTTGGTGTTTTACATCC TGG (reversed) Intergenic
No off target data available for this crispr