ID: 1108153502

View in Genome Browser
Species Human (GRCh38)
Location 13:47561253-47561275
Sequence AGCTGCTGGTCTGAGTATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108153502_1108153506 -3 Left 1108153502 13:47561253-47561275 CCTCCATACTCAGACCAGCAGCT No data
Right 1108153506 13:47561273-47561295 GCTCGCCTTGGTCACAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108153502 Original CRISPR AGCTGCTGGTCTGAGTATGG AGG (reversed) Intergenic
No off target data available for this crispr