ID: 1108161926

View in Genome Browser
Species Human (GRCh38)
Location 13:47649519-47649541
Sequence AAGTAACCTTTCAGTAACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108161926_1108161927 -1 Left 1108161926 13:47649519-47649541 CCATAGTTACTGAAAGGTTACTT No data
Right 1108161927 13:47649541-47649563 TCCTTGATCATCTGTGTTGTAGG No data
1108161926_1108161929 14 Left 1108161926 13:47649519-47649541 CCATAGTTACTGAAAGGTTACTT No data
Right 1108161929 13:47649556-47649578 GTTGTAGGTACAGAAGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108161926 Original CRISPR AAGTAACCTTTCAGTAACTA TGG (reversed) Intergenic
No off target data available for this crispr