ID: 1108164858

View in Genome Browser
Species Human (GRCh38)
Location 13:47681835-47681857
Sequence ATGGTGAAGTAGACAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108164855_1108164858 -6 Left 1108164855 13:47681818-47681840 CCATGGGGTCAGACTGGATGGTG No data
Right 1108164858 13:47681835-47681857 ATGGTGAAGTAGACAGAGGAGGG No data
1108164849_1108164858 22 Left 1108164849 13:47681790-47681812 CCAGCAGGAGAGTAGCTGAAGAG No data
Right 1108164858 13:47681835-47681857 ATGGTGAAGTAGACAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108164858 Original CRISPR ATGGTGAAGTAGACAGAGGA GGG Intergenic
No off target data available for this crispr