ID: 1108166015

View in Genome Browser
Species Human (GRCh38)
Location 13:47693901-47693923
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108166015_1108166016 15 Left 1108166015 13:47693901-47693923 CCTGTGCATGTGTGTGCACGCAC No data
Right 1108166016 13:47693939-47693961 CTTAATTTTATCACATGTATAGG No data
1108166015_1108166017 16 Left 1108166015 13:47693901-47693923 CCTGTGCATGTGTGTGCACGCAC No data
Right 1108166017 13:47693940-47693962 TTAATTTTATCACATGTATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108166015 Original CRISPR GTGCGTGCACACACATGCAC AGG (reversed) Intergenic
No off target data available for this crispr