ID: 1108167662

View in Genome Browser
Species Human (GRCh38)
Location 13:47709955-47709977
Sequence CCACAGAGGCAGAGGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108167662_1108167672 15 Left 1108167662 13:47709955-47709977 CCACCCACCCTCTGCCTCTGTGG No data
Right 1108167672 13:47709993-47710015 CTCCTGCCTTCAGAACTTGCAGG No data
1108167662_1108167675 22 Left 1108167662 13:47709955-47709977 CCACCCACCCTCTGCCTCTGTGG No data
Right 1108167675 13:47710000-47710022 CTTCAGAACTTGCAGGACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108167662 Original CRISPR CCACAGAGGCAGAGGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr