ID: 1108176807

View in Genome Browser
Species Human (GRCh38)
Location 13:47800789-47800811
Sequence TGCCAAGGTGTACTGTCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108176807_1108176810 -6 Left 1108176807 13:47800789-47800811 CCACCTGACAGTACACCTTGGCA No data
Right 1108176810 13:47800806-47800828 TTGGCATTTCCTTCCACATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108176807 Original CRISPR TGCCAAGGTGTACTGTCAGG TGG (reversed) Intergenic
No off target data available for this crispr