ID: 1108178695

View in Genome Browser
Species Human (GRCh38)
Location 13:47820217-47820239
Sequence AGGGCTAAGTAGAAAATGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108178695_1108178701 5 Left 1108178695 13:47820217-47820239 CCCTTCATTTTCTACTTAGCCCT No data
Right 1108178701 13:47820245-47820267 GGTGAGTTTTCTGTCATGAAAGG No data
1108178695_1108178703 16 Left 1108178695 13:47820217-47820239 CCCTTCATTTTCTACTTAGCCCT No data
Right 1108178703 13:47820256-47820278 TGTCATGAAAGGCTTTAAAAGGG No data
1108178695_1108178704 28 Left 1108178695 13:47820217-47820239 CCCTTCATTTTCTACTTAGCCCT No data
Right 1108178704 13:47820268-47820290 CTTTAAAAGGGATTTCAGTGAGG No data
1108178695_1108178702 15 Left 1108178695 13:47820217-47820239 CCCTTCATTTTCTACTTAGCCCT No data
Right 1108178702 13:47820255-47820277 CTGTCATGAAAGGCTTTAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108178695 Original CRISPR AGGGCTAAGTAGAAAATGAA GGG (reversed) Intergenic
No off target data available for this crispr