ID: 1108179599

View in Genome Browser
Species Human (GRCh38)
Location 13:47827751-47827773
Sequence GGGAGTTGAAAAATGTTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108179599_1108179605 -2 Left 1108179599 13:47827751-47827773 CCCACTAACATTTTTCAACTCCC No data
Right 1108179605 13:47827772-47827794 CCACCATGGACCACCCATGGTGG No data
1108179599_1108179608 10 Left 1108179599 13:47827751-47827773 CCCACTAACATTTTTCAACTCCC No data
Right 1108179608 13:47827784-47827806 ACCCATGGTGGACCCAAACCAGG No data
1108179599_1108179610 11 Left 1108179599 13:47827751-47827773 CCCACTAACATTTTTCAACTCCC No data
Right 1108179610 13:47827785-47827807 CCCATGGTGGACCCAAACCAGGG No data
1108179599_1108179602 -5 Left 1108179599 13:47827751-47827773 CCCACTAACATTTTTCAACTCCC No data
Right 1108179602 13:47827769-47827791 CTCCCACCATGGACCACCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108179599 Original CRISPR GGGAGTTGAAAAATGTTAGT GGG (reversed) Intergenic