ID: 1108179602 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:47827769-47827791 |
Sequence | CTCCCACCATGGACCACCCA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1108179600_1108179602 | -6 | Left | 1108179600 | 13:47827752-47827774 | CCACTAACATTTTTCAACTCCCA | No data | ||
Right | 1108179602 | 13:47827769-47827791 | CTCCCACCATGGACCACCCATGG | No data | ||||
1108179599_1108179602 | -5 | Left | 1108179599 | 13:47827751-47827773 | CCCACTAACATTTTTCAACTCCC | No data | ||
Right | 1108179602 | 13:47827769-47827791 | CTCCCACCATGGACCACCCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1108179602 | Original CRISPR | CTCCCACCATGGACCACCCA TGG | Intergenic | ||