ID: 1108179603

View in Genome Browser
Species Human (GRCh38)
Location 13:47827771-47827793
Sequence CACCATGGGTGGTCCATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108179603_1108179610 -9 Left 1108179603 13:47827771-47827793 CCCACCATGGACCACCCATGGTG No data
Right 1108179610 13:47827785-47827807 CCCATGGTGGACCCAAACCAGGG No data
1108179603_1108179608 -10 Left 1108179603 13:47827771-47827793 CCCACCATGGACCACCCATGGTG No data
Right 1108179608 13:47827784-47827806 ACCCATGGTGGACCCAAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108179603 Original CRISPR CACCATGGGTGGTCCATGGT GGG (reversed) Intergenic