ID: 1108179604

View in Genome Browser
Species Human (GRCh38)
Location 13:47827772-47827794
Sequence CCACCATGGGTGGTCCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108179604_1108179610 -10 Left 1108179604 13:47827772-47827794 CCACCATGGACCACCCATGGTGG No data
Right 1108179610 13:47827785-47827807 CCCATGGTGGACCCAAACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108179604 Original CRISPR CCACCATGGGTGGTCCATGG TGG (reversed) Intergenic