ID: 1108179605

View in Genome Browser
Species Human (GRCh38)
Location 13:47827772-47827794
Sequence CCACCATGGACCACCCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108179600_1108179605 -3 Left 1108179600 13:47827752-47827774 CCACTAACATTTTTCAACTCCCA No data
Right 1108179605 13:47827772-47827794 CCACCATGGACCACCCATGGTGG No data
1108179599_1108179605 -2 Left 1108179599 13:47827751-47827773 CCCACTAACATTTTTCAACTCCC No data
Right 1108179605 13:47827772-47827794 CCACCATGGACCACCCATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108179605 Original CRISPR CCACCATGGACCACCCATGG TGG Intergenic