ID: 1108179610

View in Genome Browser
Species Human (GRCh38)
Location 13:47827785-47827807
Sequence CCCATGGTGGACCCAAACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108179603_1108179610 -9 Left 1108179603 13:47827771-47827793 CCCACCATGGACCACCCATGGTG No data
Right 1108179610 13:47827785-47827807 CCCATGGTGGACCCAAACCAGGG No data
1108179604_1108179610 -10 Left 1108179604 13:47827772-47827794 CCACCATGGACCACCCATGGTGG No data
Right 1108179610 13:47827785-47827807 CCCATGGTGGACCCAAACCAGGG No data
1108179600_1108179610 10 Left 1108179600 13:47827752-47827774 CCACTAACATTTTTCAACTCCCA No data
Right 1108179610 13:47827785-47827807 CCCATGGTGGACCCAAACCAGGG No data
1108179599_1108179610 11 Left 1108179599 13:47827751-47827773 CCCACTAACATTTTTCAACTCCC No data
Right 1108179610 13:47827785-47827807 CCCATGGTGGACCCAAACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108179610 Original CRISPR CCCATGGTGGACCCAAACCA GGG Intergenic