ID: 1108192750

View in Genome Browser
Species Human (GRCh38)
Location 13:47959409-47959431
Sequence AGGGAGAGGGAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 14624
Summary {0: 1, 1: 17, 2: 270, 3: 2310, 4: 12026}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108192742_1108192750 19 Left 1108192742 13:47959367-47959389 CCTGGAGTAAAATGATGTTATTT 0: 1
1: 0
2: 2
3: 51
4: 514
Right 1108192750 13:47959409-47959431 AGGGAGAGGGAGAAGGAGGAGGG 0: 1
1: 17
2: 270
3: 2310
4: 12026

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108192750 Original CRISPR AGGGAGAGGGAGAAGGAGGA GGG Intronic
Too many off-targets to display for this crispr