ID: 1108193700

View in Genome Browser
Species Human (GRCh38)
Location 13:47970430-47970452
Sequence AGTTACGTGAAGATGATGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 129}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108193700 Original CRISPR AGTTACGTGAAGATGATGAC TGG (reversed) Intronic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
907602084 1:55782149-55782171 AGTTATCTGTAGATGATGGCAGG + Intergenic
907992759 1:59598985-59599007 AGTTAAGTGAAGATGCAGGCAGG + Intronic
909312837 1:74175228-74175250 TGTTAGGTGAAGATGATGACAGG + Intronic
910038578 1:82819338-82819360 TGTTACTAAAAGATGATGACAGG - Intergenic
910948213 1:92616686-92616708 AGTTATCTGAAGAAGATGGCAGG - Intronic
913041001 1:115023003-115023025 AGCTGTGTGAAGAAGATGACTGG + Intergenic
916387480 1:164291355-164291377 AGTTAGGTGAAGTTTATTACTGG - Intergenic
918815077 1:189171226-189171248 AGTTACCTGCAGAAGATGGCTGG - Intergenic
921763025 1:218939286-218939308 AGTTAGGTGAAGAAGGTGACTGG - Intergenic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
1064774306 10:18758506-18758528 AGTCAAGTTAAGATGAGGACTGG - Intergenic
1066957621 10:42188051-42188073 AGTTAACTGGAGAAGATGACCGG - Intergenic
1068447208 10:57138591-57138613 AGTTATCTGAAGAAGATGGCAGG - Intergenic
1068996983 10:63218381-63218403 AGAAAAGTGAAGATGTTGACTGG + Intronic
1072210905 10:93246415-93246437 GGTTAAGTGGAGGTGATGACAGG + Intergenic
1073830506 10:107378011-107378033 AGTTATCTGTAGATGATGGCAGG + Intergenic
1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG + Intronic
1079509391 11:21193509-21193531 GGCTATGTGAAGATGCTGACTGG - Intronic
1079890427 11:26045757-26045779 AGTTAAGTGAGGAAGGTGACAGG - Intergenic
1085453080 11:76648805-76648827 ATTTATGTGAAGCTGATGAAAGG + Intergenic
1093016286 12:14157733-14157755 TGTTACGTATAGATGATGTCTGG + Intergenic
1093049672 12:14490990-14491012 AGTTACCTGCAAAAGATGACAGG + Intronic
1095410025 12:41911477-41911499 AGTACAGTGAAGATGCTGACTGG + Intergenic
1097022308 12:56028995-56029017 AGGAGGGTGAAGATGATGACAGG - Intronic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1099995069 12:89769557-89769579 AGTTATCTGAAGAGGATGGCAGG + Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1106841112 13:33685752-33685774 AGTTACTTGAAGAGGATGAAGGG + Intergenic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108193700 13:47970430-47970452 AGTTACGTGAAGATGATGACTGG - Intronic
1110374004 13:74771617-74771639 AGTTTCTCGAAGATCATGACTGG + Intergenic
1111470900 13:88681086-88681108 AGTTATGTACAGATGATGGCAGG + Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1116251614 14:42491515-42491537 AGTTGAGTGAAGATAATGATAGG - Intergenic
1117219398 14:53587077-53587099 AGCTTCCTGAAGATGATGTCTGG - Intergenic
1117547651 14:56806244-56806266 AATTAGGTGAAAATGATTACCGG - Intronic
1119107566 14:71938866-71938888 AGTTACCTGCAGAAGATGACAGG + Intronic
1120945433 14:89990747-89990769 AGTTATTTGAAGTTGAAGACAGG + Intronic
1121403506 14:93703434-93703456 TGCTATGTGAAGATGAAGACAGG - Intronic
1124390076 15:29246946-29246968 AAATATGTGCAGATGATGACTGG + Intronic
1125911667 15:43445334-43445356 AGTTACAAGAAGATCATGTCAGG - Intronic
1126358358 15:47819862-47819884 ATTTACTTTAAAATGATGACTGG - Intergenic
1128190540 15:65690540-65690562 AGTTAAATGAAGGTGATGAGTGG + Exonic
1134891732 16:17847028-17847050 AGTTGCATGGAGAAGATGACAGG - Intergenic
1138711669 16:58977093-58977115 CATTACGTGAAGCTGATAACTGG - Intergenic
1139301031 16:65945511-65945533 AGTTATGTGATGAGGAGGACAGG + Intergenic
1141950639 16:87336953-87336975 AGTTAGGTCTAGATAATGACTGG - Intronic
1153822914 18:8847678-8847700 TCTTACTTGAAGATGATGACAGG - Intergenic
1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1156018239 18:32570300-32570322 AGTTAACTCAAGATGAGGACTGG - Intergenic
1159398856 18:67903313-67903335 CTTAACATGAAGATGATGACAGG + Intergenic
927330608 2:21858903-21858925 AGTTACCAGAGGATGATGAGGGG + Intergenic
929390997 2:41468353-41468375 AATTGCTTGAAGATGGTGACCGG - Intergenic
930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG + Intergenic
930449774 2:51520525-51520547 GGTCACGTGAAGATGAAGGCAGG - Intergenic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
933497963 2:83075197-83075219 ATTTTCATGAAGTTGATGACAGG - Intergenic
934305739 2:91820565-91820587 AGTTAACTGGAGAAGATGACCGG - Intergenic
934327517 2:92032177-92032199 AGTTAACTGGAGAAGATGACCGG + Intergenic
934465906 2:94262756-94262778 AGTTAACTGGAGAAGATGACCGG + Intergenic
938813274 2:134873142-134873164 AGTCAGGGGAAGATGATGAAGGG + Intronic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
942987905 2:182163965-182163987 AGTTATCTGCAGATGATGCCAGG - Intronic
1168819014 20:761183-761205 AGTTACGTCAAGGTGATGCTGGG - Exonic
1170472339 20:16680839-16680861 AGTTAAGTTAAAATGAGGACAGG - Intergenic
1175386529 20:58599478-58599500 GGCCACGTGAAGATGAAGACAGG - Intergenic
1179415153 21:41192550-41192572 AGTTATCTGAAGAAGATGGCAGG + Intronic
1180587041 22:16901929-16901951 AGTTAACTGGAGAAGATGACCGG + Intergenic
951328287 3:21332296-21332318 CGTTAGGTGAAGTTGCTGACTGG - Intergenic
952652700 3:35745614-35745636 AGTTAGATGAATATGATAACTGG + Intronic
954363312 3:50133748-50133770 AGTTACCTGCAGATGAGGACTGG - Intergenic
955677016 3:61459375-61459397 ACTTATGTGAAAATGATGGCTGG - Intergenic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
960494749 3:118360810-118360832 AGTTATCTGAAGATGATGGCAGG + Intergenic
963553616 3:146757799-146757821 AGATAAGTGAATATGATGATGGG - Intergenic
964357456 3:155863693-155863715 AGTTACGTGAAACTGCTGCCTGG + Intergenic
964945502 3:162218804-162218826 AATTACGTAAAGAAAATGACAGG - Intergenic
969207716 4:5660136-5660158 AGTTAAGTGAAAATGAAGAATGG + Intronic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG + Intergenic
972805913 4:42529297-42529319 AGTTACCTGCAGATTATGGCAGG - Intronic
973024171 4:45246272-45246294 AGTTATTTGAAGATGATTACTGG - Intergenic
974724520 4:65781488-65781510 AATTACATAAAGATGATCACGGG + Intergenic
974764598 4:66326953-66326975 TGTTTCTTGAAGGTGATGACAGG - Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
978173009 4:105696381-105696403 AGATAAGTGATGATGATGATGGG - Intronic
985847934 5:2367344-2367366 AACTACGTGAAAATAATGACAGG - Intergenic
986938334 5:12918780-12918802 AGTTACCTGAAGAAGATGGCAGG + Intergenic
988258173 5:28848511-28848533 AGTTACGTGCAGATAATGACAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992242936 5:74789722-74789744 AGTTATCTGAAGAAGATGGCAGG - Intronic
992970977 5:82057474-82057496 AGCCATGTGAAGATGAAGACTGG - Intronic
994236183 5:97365696-97365718 AGTTAAGAGCAGATGAAGACAGG + Intergenic
995060853 5:107810391-107810413 AGTTGGGTGAAGGTGGTGACTGG - Intergenic
996205512 5:120730416-120730438 AGTTAGATAAATATGATGACTGG + Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
998765469 5:145482092-145482114 AGTTATGTGATAAAGATGACAGG - Intronic
999967953 5:156830051-156830073 TGCAACGTGAATATGATGACTGG + Intergenic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1011729779 6:90249321-90249343 AGTTATGGGAGGAAGATGACAGG - Intronic
1011854685 6:91675120-91675142 AGTTATGACAAAATGATGACAGG - Intergenic
1016097827 6:140059882-140059904 AGCTACCTGAAGATGGTGATGGG + Intergenic
1017069830 6:150565857-150565879 AGGTACGTGAAGATGGTGAGAGG - Intergenic
1017495951 6:154983565-154983587 AGTGAAGAGAAGATGATGAATGG + Intronic
1024460907 7:49658451-49658473 AGTTACCTGATGAGGATGATGGG - Intergenic
1024759906 7:52583176-52583198 ACTTAGGTGAAGAGGATGGCTGG - Intergenic
1030405791 7:109111284-109111306 ACTCACGTGAAGCTGATGCCTGG + Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1032273384 7:130432077-130432099 AGGTTGGTGAAGATGATGAGGGG + Intronic
1035529017 8:336794-336816 AGTTGGGTGATGAAGATGACAGG + Intergenic
1039613621 8:38937950-38937972 AGTGATGGGAAGATGAGGACGGG + Intronic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1046014424 8:108588721-108588743 AGTTTTGTGAAGTTGAAGACAGG - Intergenic
1048380178 8:133858693-133858715 AGTTGCCTGAGAATGATGACTGG - Intergenic
1048481927 8:134804994-134805016 TATTAGCTGAAGATGATGACTGG - Intergenic
1050144329 9:2549954-2549976 AGGTACATGAAAATGAAGACAGG - Intergenic
1051966460 9:22834547-22834569 AGTTACCTGCAGAAGATGGCAGG - Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1052847397 9:33349372-33349394 AGTAATGTGGAGAGGATGACAGG + Intronic
1053695960 9:40639533-40639555 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054307207 9:63438751-63438773 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054405940 9:64762743-64762765 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054439566 9:65248230-65248252 AGTTAACTGGAGAAGATGACCGG + Intergenic
1054490841 9:65773709-65773731 AGTTAACTGGAGAAGATGACCGG - Intergenic
1056263373 9:84871923-84871945 AGTGACGTCAAGATGTTGTCTGG - Intronic
1202778407 9_KI270717v1_random:13146-13168 AGTTAACTGGAGAAGATGACCGG + Intergenic
1191630040 X:63312619-63312641 AGTTATCTGAAGAAGTTGACAGG + Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1193297777 X:79852642-79852664 AGTTATGTGCAGATGATGGCAGG - Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1194179594 X:90695967-90695989 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1195248138 X:103015371-103015393 AGATACCTGAAGTTGATGAGTGG + Intergenic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1198608219 X:138368135-138368157 AAATACGTGAAGAACATGACTGG - Intergenic
1199554393 X:149090656-149090678 AAATACGTAAAGATCATGACTGG + Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200526256 Y:4278136-4278158 AGTTATCTGAAGAAGATGGCAGG + Intergenic
1201193721 Y:11471449-11471471 AGTTAACTGGAGAAGATGACAGG + Intergenic