ID: 1108201070

View in Genome Browser
Species Human (GRCh38)
Location 13:48043716-48043738
Sequence GCCTCTGTAGGGATTTGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 170}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108201062_1108201070 26 Left 1108201062 13:48043667-48043689 CCACCTCTGGGTGCTTCCTCATT 0: 1
1: 0
2: 4
3: 23
4: 295
Right 1108201070 13:48043716-48043738 GCCTCTGTAGGGATTTGAGTTGG 0: 1
1: 0
2: 2
3: 19
4: 170
1108201064_1108201070 10 Left 1108201064 13:48043683-48043705 CCTCATTCTTCAGTCCTCTTTTT 0: 1
1: 0
2: 12
3: 61
4: 761
Right 1108201070 13:48043716-48043738 GCCTCTGTAGGGATTTGAGTTGG 0: 1
1: 0
2: 2
3: 19
4: 170
1108201063_1108201070 23 Left 1108201063 13:48043670-48043692 CCTCTGGGTGCTTCCTCATTCTT 0: 1
1: 0
2: 1
3: 38
4: 265
Right 1108201070 13:48043716-48043738 GCCTCTGTAGGGATTTGAGTTGG 0: 1
1: 0
2: 2
3: 19
4: 170
1108201065_1108201070 -4 Left 1108201065 13:48043697-48043719 CCTCTTTTTGCCCTGTCTAGCCT 0: 1
1: 0
2: 0
3: 22
4: 218
Right 1108201070 13:48043716-48043738 GCCTCTGTAGGGATTTGAGTTGG 0: 1
1: 0
2: 2
3: 19
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108201070 Original CRISPR GCCTCTGTAGGGATTTGAGT TGG Intronic
901830612 1:11889793-11889815 GCCCCTGTAGGTGTTTGGGTTGG - Intergenic
902049344 1:13549557-13549579 TCCCCTGTAGGGATTGGATTTGG + Intergenic
903596775 1:24501648-24501670 GCCTCTGAAAGGTCTTGAGTGGG + Intergenic
903896174 1:26606642-26606664 GCCACTGGAGGGTTTTTAGTAGG + Intergenic
904045933 1:27608261-27608283 GCCACTGAAGGGTTTTGAGCAGG - Intergenic
904154774 1:28473772-28473794 GGCTCTGGAGGTATATGAGTAGG - Exonic
904255122 1:29249854-29249876 GCCACAGTAGGTGTTTGAGTAGG - Intronic
906030753 1:42718237-42718259 GCCTCTGAAGGATTTTGAGCAGG - Intergenic
906186723 1:43867771-43867793 GCTCTTGTAGGCATTTGAGTTGG + Intronic
906899389 1:49817036-49817058 GCCTCTTCAGGGATGTGGGTAGG - Intronic
910711701 1:90188672-90188694 TTCTCTGGAGGGATTTGAGCTGG + Intergenic
912938465 1:114024168-114024190 GCCTCTGCAGGGTTTTAAGCAGG + Intergenic
916270153 1:162932282-162932304 GCCACTGAAAGGATTTAAGTGGG - Intergenic
918441987 1:184576793-184576815 GCCTCTGAAGGGTTTTAAGCAGG - Intronic
918637808 1:186799618-186799640 GCCTCTGTGGGAGTTTGAGTAGG + Intergenic
920709673 1:208283154-208283176 GCCCTTGTAGGCATTAGAGTTGG - Intergenic
922083562 1:222323530-222323552 GCCTGGGTAGGAATTTGAATGGG - Intergenic
923425588 1:233865704-233865726 GCCTCTGGAGGGCTTGGAGAAGG - Intergenic
924048455 1:240056074-240056096 GCCTCTGTAGGCATGTGATCTGG - Intronic
1063233550 10:4089458-4089480 GCATATTTAGAGATTTGAGTGGG + Intergenic
1066325604 10:34354839-34354861 GCCTCTGAAGGGATTTCAGCAGG + Intronic
1068555800 10:58457329-58457351 ACTTCAGTAGGGCTTTGAGTAGG - Intergenic
1068570518 10:58623081-58623103 CCCTATGTAGAGATTTGAGAAGG + Intronic
1068763962 10:60742654-60742676 GCCATTGTAGGGTTTTCAGTAGG - Intergenic
1070693704 10:78546231-78546253 GGCTTTGTAGGCATTTGACTTGG - Intergenic
1071435876 10:85647797-85647819 GCCTCTGCAGGCGTCTGAGTTGG - Intronic
1073879596 10:107965463-107965485 GCCTTTGTAGTTATGTGAGTTGG - Intergenic
1074461777 10:113644887-113644909 GACTCTGAAGGCATTTGACTTGG - Intronic
1078075819 11:8159432-8159454 GCCACTGTAGAGTTTTGAGGAGG + Intronic
1079350238 11:19685941-19685963 GCCTCTGGAGAGTTTTAAGTTGG - Intronic
1083809698 11:65096639-65096661 GCGTCTGAGGGGATGTGAGTAGG + Intronic
1083993323 11:66259603-66259625 GCCTCTGGAGGGCTTTAAGCAGG + Intronic
1085108547 11:73867160-73867182 CCCTTTTTAGGGATTTGAGATGG + Intergenic
1085175978 11:74488524-74488546 GCCCCTGTAGGCATTCGAGTTGG - Intergenic
1087644814 11:100796409-100796431 GCCACTGTAAGGTTTTTAGTTGG - Intronic
1090382996 11:126339761-126339783 GGCTCTGTAGGCATTTGAAGAGG + Intronic
1090688203 11:129148911-129148933 GCCACTGTAGGGGATTGAGGGGG - Intronic
1091727326 12:2855123-2855145 GCATCTGTGGGCATTGGAGTCGG + Intronic
1094090992 12:26649638-26649660 ATCTCTGGAGGGATTTGAGAAGG - Intronic
1095651223 12:44611923-44611945 GCCACTGTAGGGATTTTAGATGG - Intronic
1096785344 12:54014191-54014213 GCCTGAGTAGAGAATTGAGTCGG + Intronic
1098172613 12:67762112-67762134 CCCTTTGTAGGGCTTTGAGTTGG - Intergenic
1098555718 12:71816740-71816762 GCCACTGGAGGGTTTTAAGTAGG + Intergenic
1098595174 12:72265344-72265366 GCCTGTATAGGGATGTGAATGGG + Intronic
1099171944 12:79375468-79375490 GCCACTGCAGGGATTTAAGCAGG + Intronic
1101285684 12:103309879-103309901 GCCTCTGAAGGCATTTGCTTTGG - Intronic
1102396632 12:112591465-112591487 GTCCCTGTAGCCATTTGAGTTGG + Intronic
1102483520 12:113240605-113240627 TCCTCTTAAGGGATGTGAGTTGG + Intronic
1104266894 12:127241955-127241977 GCCCCTGTAGGAATTTCAGCAGG - Intergenic
1106518513 13:30475946-30475968 GCCCCTGCAGACATTTGAGTTGG + Intronic
1108201070 13:48043716-48043738 GCCTCTGTAGGGATTTGAGTTGG + Intronic
1110248646 13:73356577-73356599 GCCACTGAAGGGTTTTAAGTGGG + Intergenic
1117819008 14:59629340-59629362 GCCTCTGTAGGGTTTTGCTTCGG - Intronic
1119032824 14:71205749-71205771 GCCTCTGTGGGGCTTTGGCTAGG + Intergenic
1120190157 14:81433396-81433418 GCCACTGAAGAGTTTTGAGTTGG - Intronic
1121856839 14:97278005-97278027 GCCTCTGCAGAGATGTCAGTGGG + Intergenic
1124094557 15:26637045-26637067 GCCACTGTAGGGTTTTGAACAGG - Intronic
1124661470 15:31553919-31553941 GCCCCTGGAGGGTTTTGAGCCGG - Intronic
1125063192 15:35449323-35449345 CTCTCTGTAGGGATTAGAGATGG - Intronic
1125166549 15:36712593-36712615 GGCTCTGTAGTTATTTGTGTGGG - Intronic
1126518324 15:49559207-49559229 GACTCTGCAGGGAGTTGAGATGG - Intronic
1128184473 15:65632845-65632867 GCCTTGGAAGGGATTTGTGTAGG + Intronic
1128693909 15:69746043-69746065 GCTTCTGTAGGAACATGAGTGGG + Intergenic
1129817021 15:78564587-78564609 GGGTCTGGAGGGATTTGAGACGG + Intergenic
1130958481 15:88644102-88644124 GTCTATGTAGGGAATTAAGTGGG + Intronic
1134885415 16:17786594-17786616 GCCACTGGAGGGCTTTGAGCTGG - Intergenic
1138533870 16:57649460-57649482 GACTCTGGAGGGAGTTGAGGAGG + Intronic
1140588601 16:76324223-76324245 GCCACTGTATCGATTTCAGTTGG - Intronic
1143425479 17:6832642-6832664 GCCTATCTAGGGATGTGCGTAGG - Intergenic
1147139000 17:38451218-38451240 GCCTCTGTGGGGACTTCAGGGGG - Intronic
1150202061 17:63367876-63367898 GCCTCTGTAGCCTTTTGAGAAGG + Intronic
1153812569 18:8764995-8765017 GCCTATGTAGGTATGTGACTAGG + Intronic
1157444477 18:47734495-47734517 GACTCTGAAGGAGTTTGAGTGGG + Intergenic
1158485280 18:57860711-57860733 GCCTCTGTGGGGTATTAAGTAGG - Intergenic
1164651229 19:29892296-29892318 GCCTGTATATGCATTTGAGTGGG + Intergenic
1165060581 19:33203251-33203273 GCGTGTGTAGGTATTTGAGCAGG + Intronic
1165127720 19:33612483-33612505 GCCTCTGGAGGGAATTAAATAGG - Intergenic
1165370364 19:35401844-35401866 GCCTCTGTGGGGTTCTGAGTAGG + Intergenic
1166157428 19:40924422-40924444 CCCTCAGAAAGGATTTGAGTAGG - Intergenic
1166166297 19:40991455-40991477 CCCTCAGAAAGGATTTGAGTAGG - Exonic
1167012820 19:46820164-46820186 GCCACAGAAGGGATTTGAGGAGG + Intergenic
926905253 2:17799524-17799546 GCCTCTGTTGTGCTTAGAGTTGG - Intronic
934733303 2:96672940-96672962 GCCTCTGAAGGCCTTTGAGAGGG + Intergenic
935834164 2:107031950-107031972 GACTCTGTTGGGATTAGGGTTGG - Intergenic
941137289 2:161733587-161733609 GCCCCAGTAGGGACTTGGGTGGG - Intronic
941238258 2:163003035-163003057 GCCTTTGTAGGGTTATTAGTTGG - Intergenic
941631835 2:167892623-167892645 GCCTCTAAAGGGTTTTGAGTAGG + Intergenic
942613238 2:177763415-177763437 GCCACTGTTGGGATTTCAGAAGG + Intronic
943609812 2:190019151-190019173 GCCTGTGTAGGGAATTGAAGTGG + Intronic
945342294 2:208671135-208671157 GCCTCTGCAGGCATGTGAATTGG - Intronic
945364616 2:208936394-208936416 ACCTCTCTAGTAATTTGAGTAGG - Intergenic
946573023 2:221045008-221045030 GTGACTGGAGGGATTTGAGTAGG - Intergenic
946894522 2:224309908-224309930 GCCTCCACAGGGATTTGGGTTGG + Intergenic
947116915 2:226781735-226781757 GCCTCTGTAGGGACTTGTGAGGG + Intronic
948379373 2:237542079-237542101 GCCACTGCAAGGATCTGAGTAGG + Intronic
1170944577 20:20879678-20879700 GCCTCTGAAGGGTTTTGAGTAGG + Intergenic
1173370255 20:42428758-42428780 GCTTGTGTAGGGAAATGAGTGGG - Intronic
1174283382 20:49455194-49455216 GCCACTGGAAGGCTTTGAGTGGG + Intronic
1175966152 20:62661170-62661192 GCCTCTGTAAGGACCGGAGTCGG + Exonic
1178830686 21:36054075-36054097 GGCTTTGTGGGGACTTGAGTGGG - Intronic
1179178609 21:39026594-39026616 GCCGCTGCAGGGCTTTGAGAAGG + Intergenic
1181470796 22:23138165-23138187 GCCCCTGTGGGGATCTGGGTTGG + Intronic
1181546095 22:23603492-23603514 GTCTCTGGAGGGATTTGGGTAGG - Intergenic
1182775385 22:32827684-32827706 GCCACTGGAGGGCTTTGAGCAGG - Intronic
1185070580 22:48653701-48653723 GCCTCTGTAGAGAGATGAGACGG + Intronic
949856553 3:8467169-8467191 GCCACTGGAGGGTTTTCAGTAGG - Intergenic
951599891 3:24362159-24362181 GCCACTGAAGGGTTTTGAGGAGG - Intronic
955085394 3:55697757-55697779 CTCTCTGTTGGGGTTTGAGTGGG + Intronic
956326901 3:68062973-68062995 GCCCCTGTGGGCATTTGAGTTGG - Intronic
957266652 3:77974930-77974952 GAATCTATAGGGATTTAAGTTGG + Intergenic
959615963 3:108347545-108347567 GCCACTGGAGGGATTTAATTAGG + Intronic
959754701 3:109883623-109883645 GCCCCAGTAGGGATCTGTGTGGG + Intergenic
960280199 3:115772770-115772792 GCCACTGTTTGGATTGGAGTAGG + Intergenic
960326123 3:116298242-116298264 GGCTCTGCAGGGATTTCTGTTGG - Intronic
963095381 3:141533272-141533294 TCCACTTTAGGGCTTTGAGTAGG + Intronic
963959088 3:151287787-151287809 GCCTCTTTAGGGATTTCTATGGG + Intronic
967395558 3:189004725-189004747 GGCTGAGTAGGCATTTGAGTCGG - Intronic
969316213 4:6382884-6382906 GCCGCTGGAGGGTTTTGAGCAGG - Intronic
977507059 4:97915820-97915842 GCCACTGTAGGTTTTTGAGATGG + Intronic
979107218 4:116703966-116703988 GCCTCAGTAGGGAAATGACTTGG - Intergenic
980065416 4:128182623-128182645 GCCACTGTAGGGTTATTAGTTGG - Intronic
981594140 4:146400059-146400081 ACCTATGTAGGGAATTGAGAAGG + Intronic
985486601 5:155326-155348 GCCTCTGTTGTGAGTTGAGAGGG - Exonic
990531727 5:56680784-56680806 GCCTCTGTAGAGATTTCTGTTGG - Intergenic
991050468 5:62267356-62267378 GCCTCTGTGTGCATTTGTGTAGG + Intergenic
991409077 5:66329127-66329149 GTCTATGTGGGGAATTGAGTTGG + Intergenic
993857753 5:93097115-93097137 ACTTCTGTAGGGAATTGAGCAGG + Intergenic
994762435 5:103872874-103872896 GCATCTATAGGCATTTGAGGAGG - Intergenic
996093865 5:119377892-119377914 GGTTCTGTAGGCATTTGCGTAGG - Intronic
998358956 5:141567449-141567471 GCTTCTCTTGGGTTTTGAGTAGG - Intronic
998649667 5:144103921-144103943 ACCTCTGAAGGGATCTGTGTGGG + Intergenic
999088713 5:148915932-148915954 GCTTCTGTTGAGATTTGAATTGG + Intergenic
999678915 5:154037048-154037070 ACCTCTGTAGGCATCTGAGTTGG + Intronic
1001937378 5:175714943-175714965 GCCCCTGAAGGCATCTGAGTTGG - Intergenic
1002831205 6:822986-823008 GCCCCTATAGCGATTTGAATCGG - Intergenic
1003240502 6:4341351-4341373 TCCACTGGAGGGTTTTGAGTGGG - Intergenic
1007075678 6:39064735-39064757 GCCTCTGCTGGGATGTGAATGGG + Intronic
1007420856 6:41718777-41718799 GCCCCTGCAGGCATTTGAGTTGG - Intronic
1008532711 6:52478959-52478981 GCCCCTATAGGCATTTAAGTTGG + Intronic
1010964336 6:82186233-82186255 GCCACTGTAGGGTTATTAGTTGG - Intronic
1012290347 6:97447933-97447955 GCCTCTGTAAGGTTTTGAGTTGG - Intergenic
1013703697 6:112806709-112806731 GCCTCTGAAGGCAGCTGAGTTGG - Intergenic
1013712887 6:112921905-112921927 GCCACTGTAGGGATTTTAATTGG - Intergenic
1013777431 6:113693968-113693990 GCCTTTGTAGGAATTTAAGCAGG - Intergenic
1014236873 6:118967930-118967952 ACCTCTCTAGGGTTTTGGGTGGG - Intronic
1016737426 6:147494454-147494476 GCCACTGGAGGGTTTTGAGCAGG - Intergenic
1017976207 6:159359676-159359698 GCCTCTGTGGGCATTTGATGTGG - Intergenic
1020129611 7:5552309-5552331 GCCTCTGTTGGGAATTGACAGGG - Intronic
1020373198 7:7457182-7457204 GCCACTGGAGGGTTTTGAGAAGG + Intronic
1020609095 7:10372986-10373008 GCCATTGTTGAGATTTGAGTAGG + Intergenic
1021803270 7:24329415-24329437 GCTTCTGAAGGCATTTGAGTTGG + Intergenic
1026674152 7:72415332-72415354 GTCCCTGTAGGCATTTGAGCTGG - Intronic
1027598049 7:80201215-80201237 GCATCTGTGGAGATTTAAGTGGG + Intronic
1029379006 7:100200380-100200402 GCCTCTGTGGGGGTGGGAGTAGG + Intronic
1030690576 7:112528474-112528496 GCCACTGTAGGGCTTGGAGAAGG - Intergenic
1031425665 7:121602573-121602595 GTGTGAGTAGGGATTTGAGTAGG + Intergenic
1031871002 7:127090230-127090252 GCCTTTGAAGGGATTTGATTTGG - Intronic
1033152986 7:138932768-138932790 GACTCCGTAGGGTCTTGAGTGGG - Intronic
1035338428 7:158144861-158144883 GCCTCTGTGTGGGTTTGAGAGGG - Intronic
1036760643 8:11506458-11506480 GCCTCTGGAGGGGTGTGGGTGGG + Intronic
1038417198 8:27405633-27405655 GCCTCTGTAGGTGTCTGTGTGGG - Intronic
1039379892 8:37075487-37075509 GCCTCAGAAGGCATTTTAGTGGG - Intergenic
1041720871 8:60974204-60974226 GCCTCTGTGGGGAGGTGAGATGG + Intergenic
1043286654 8:78540434-78540456 GGCCCTGCAGGGATTTGACTAGG - Intronic
1045163635 8:99578711-99578733 GCCTCTGAAGCAAGTTGAGTTGG + Intronic
1046534108 8:115486390-115486412 GCTACTGTAGGGATATTAGTTGG - Intronic
1046825740 8:118689583-118689605 ACCTCTGTGGGACTTTGAGTGGG - Intergenic
1047730927 8:127727441-127727463 ACCTCTGTAAGCATCTGAGTTGG + Intergenic
1048221694 8:132548011-132548033 GCCTTTGCAGGTTTTTGAGTAGG + Intergenic
1048450054 8:134525201-134525223 GGCTGTACAGGGATTTGAGTTGG - Intronic
1049229853 8:141476291-141476313 GCCTCTGCAGGGCCTTGAGCTGG + Intergenic
1050349585 9:4727863-4727885 GCCACTGTAGGGTTATTAGTTGG + Intronic
1050591270 9:7162840-7162862 GCCTCTGTTGGGATTCGAGAAGG + Intergenic
1054821971 9:69531649-69531671 GCCTCTGTAGGTAAATCAGTAGG + Intronic
1055336889 9:75240865-75240887 GCCTCTGTGGGGATTTTAACTGG - Intergenic
1055355377 9:75432002-75432024 GACTCTGTAGGGACTTGGATGGG + Intergenic
1056122888 9:83507012-83507034 GCCTCTGAAGGCCTTTCAGTGGG - Intronic
1059305867 9:113352693-113352715 GCCATTGGAGGGTTTTGAGTAGG + Intronic
1061121490 9:128645650-128645672 GCCCCTGTAGGGATATTAATTGG - Intronic
1062687434 9:137821707-137821729 GCTCCTGTAGGGATTTGATTGGG + Intronic
1203791124 EBV:152132-152154 GCCTCTGTTGAGATTGGCGTCGG + Intergenic
1186132533 X:6483750-6483772 GCCTCTGAAGGGGGTTGAGATGG + Intergenic
1186521189 X:10208352-10208374 GCGTGTGTAGGGATTGGGGTAGG - Exonic
1186912125 X:14179331-14179353 GTGTCTGGAGGGCTTTGAGTTGG - Intergenic
1189060146 X:37745064-37745086 GCCACTGTAGGGTTATTAGTTGG + Intronic
1189263696 X:39697151-39697173 GCCACTGTAGGGATATTAATTGG + Intergenic
1189313262 X:40034880-40034902 GTCTCTGCAGGGGTTTCAGTGGG + Intergenic
1190156099 X:47993546-47993568 ACCTATGTAGGAATTTGAGGAGG + Intronic
1190325320 X:49203815-49203837 GCCATGGGAGGGATTTGAGTAGG - Intergenic
1194419062 X:93649897-93649919 GCCCCAGTAGGGACTTAAGTAGG - Intergenic
1197271104 X:124425754-124425776 GCCACTGAAGGGCTTTAAGTAGG + Intronic
1199661224 X:150052861-150052883 CCAACTGTAGGGATCTGAGTAGG + Intergenic