ID: 1108201888

View in Genome Browser
Species Human (GRCh38)
Location 13:48052533-48052555
Sequence GTGGTCTGGTTTACCTCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108201888_1108201893 -1 Left 1108201888 13:48052533-48052555 CCAAGAGAGGTAAACCAGACCAC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1108201893 13:48052555-48052577 CAGGTGGAAGTCTGTCAAGTAGG 0: 1
1: 0
2: 0
3: 14
4: 119
1108201888_1108201897 26 Left 1108201888 13:48052533-48052555 CCAAGAGAGGTAAACCAGACCAC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1108201897 13:48052582-48052604 ATGAACTGCCTTGAGGGAGTTGG 0: 1
1: 0
2: 0
3: 29
4: 175
1108201888_1108201894 19 Left 1108201888 13:48052533-48052555 CCAAGAGAGGTAAACCAGACCAC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1108201894 13:48052575-48052597 AGGAGCCATGAACTGCCTTGAGG 0: 1
1: 0
2: 2
3: 13
4: 140
1108201888_1108201895 20 Left 1108201888 13:48052533-48052555 CCAAGAGAGGTAAACCAGACCAC 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1108201895 13:48052576-48052598 GGAGCCATGAACTGCCTTGAGGG 0: 1
1: 0
2: 10
3: 32
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108201888 Original CRISPR GTGGTCTGGTTTACCTCTCT TGG (reversed) Intergenic
900161879 1:1227751-1227773 GTGGTCAGGTTGACCCATCTTGG + Intronic
902743590 1:18457871-18457893 ATTGTCTTGTTTCCCTCTCTAGG - Intergenic
903795982 1:25929275-25929297 GTGTACTGGTTTGCCTCTCTGGG - Intergenic
904722818 1:32523354-32523376 GTGGCATGGTTTATGTCTCTGGG + Intronic
906660167 1:47576295-47576317 GTGCTTTGGTTTTCCTATCTGGG + Intergenic
908917400 1:69145364-69145386 TTGGTATGGTTTACCACTATTGG - Intergenic
913287503 1:117240378-117240400 TTGGTCTAGGTTACCACTCTAGG + Intergenic
916363673 1:163999397-163999419 GTGCTCTGGTTTGCCTTTCAAGG - Intergenic
916622604 1:166516920-166516942 CTGGTCTGGTATACATCTCAGGG + Intergenic
916714618 1:167438720-167438742 GGAGTGTGGTTTCCCTCTCTGGG + Intronic
924174953 1:241381189-241381211 ATTGTCTTTTTTACCTCTCTTGG - Intergenic
924280324 1:242430611-242430633 GTGGGCTGGTTTCCCTATGTTGG + Intronic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1064488895 10:15828912-15828934 GTAAGCTGCTTTACCTCTCTAGG + Intronic
1066100021 10:32109686-32109708 GTGGCCTGGTTGACCTCTCAGGG - Intergenic
1070320560 10:75351853-75351875 GTGAATTGCTTTACCTCTCTGGG + Intergenic
1073678218 10:105673606-105673628 GTGGAGGGGGTTACCTCTCTGGG + Intergenic
1075250018 10:120859891-120859913 GTTGTCTGGTTAAACTCTCAAGG - Intronic
1077408304 11:2392304-2392326 GAGGCCTGGCATACCTCTCTGGG - Intronic
1081489101 11:43553573-43553595 CTGGCCTGGTTTTCCTCACTTGG - Intergenic
1082906954 11:58318628-58318650 GTGGTCTGTATTATATCTCTGGG + Intergenic
1085346427 11:75771008-75771030 GTGGCCTAGTTTGCCTCTGTGGG + Intronic
1086783217 11:90932457-90932479 TTGGCCTGGTTTCTCTCTCTTGG + Intergenic
1088571741 11:111229653-111229675 TTGTTCTGGTTTACATTTCTGGG - Intergenic
1088591158 11:111404484-111404506 ATGGTGTGCTTCACCTCTCTAGG - Intronic
1088870689 11:113887896-113887918 CTGGTCTGGTTCACCTGCCTCGG - Intergenic
1089317729 11:117603436-117603458 GTGGGCAAGTTAACCTCTCTAGG + Intronic
1090021175 11:123130324-123130346 GTGGTCTGGTAGAGCTCCCTGGG + Intronic
1094723972 12:33093319-33093341 GTGGTCTGTCCTACTTCTCTGGG + Intergenic
1098758192 12:74390691-74390713 TAGATCTGGTTTTCCTCTCTAGG + Intergenic
1101623389 12:106413556-106413578 GTGTTCTGTCTTATCTCTCTAGG + Intronic
1102440656 12:112961653-112961675 GTGCTCTGGTTTTTCTGTCTTGG - Intronic
1103148270 12:118614196-118614218 AGGGTCAGGTTTACTTCTCTTGG + Intergenic
1103176584 12:118869292-118869314 TTGTTCTGGTTTCCCTTTCTTGG + Intergenic
1105532423 13:21231600-21231622 GTGGTCTAGTTTAGGTCTCCAGG - Intergenic
1108201888 13:48052533-48052555 GTGGTCTGGTTTACCTCTCTTGG - Intergenic
1108423558 13:50274910-50274932 GTGGTTTTTTTTACCTCTCTAGG + Intronic
1112780373 13:102894084-102894106 GTGGTAGTGTTTATCTCTCTAGG + Intergenic
1114719148 14:24861829-24861851 TTGGTCTGGTTTGCAACTCTGGG - Intronic
1117339983 14:54784439-54784461 AAGGTCTGGTGTACCTCCCTGGG - Intronic
1118827712 14:69398899-69398921 GTGGGCTGGTTTCCTGCTCTGGG + Exonic
1121501005 14:94437549-94437571 GGGGTCTGGTTTATTTCTTTTGG - Intergenic
1121516808 14:94557743-94557765 GTGGGCTGTTTAGCCTCTCTAGG - Intergenic
1122044588 14:99014344-99014366 GTGGTTTGGTTTGGCTCTCCAGG - Intergenic
1122939019 14:104972998-104973020 GTGGTCAAGTGTGCCTCTCTTGG - Intronic
1124193068 15:27597370-27597392 ATGGTCTGGTTAAGCTCTCTGGG - Intergenic
1125614811 15:41001196-41001218 GTGGTCTGGGTGCCCTCTCTAGG + Intronic
1129593529 15:76939696-76939718 GTGGTGTGGTTTCCCTTCCTAGG + Intronic
1130989697 15:88869008-88869030 GAGGACTGAGTTACCTCTCTTGG + Intronic
1131367198 15:91851687-91851709 CTGGTCAGGTTAACCTTTCTAGG + Intergenic
1133191901 16:4140027-4140049 AAAGCCTGGTTTACCTCTCTGGG + Intergenic
1137062986 16:35809187-35809209 CGTGTCTGGTTTTCCTCTCTGGG + Intergenic
1139328552 16:66170118-66170140 GTGGCCTGGTTTTCTTCTGTTGG + Intergenic
1143998282 17:11028068-11028090 GTGGTCTGGTTCACCCCACGTGG - Intergenic
1144031849 17:11330145-11330167 GGGTTCTGGTTGACCTGTCTTGG + Intronic
1144170409 17:12654541-12654563 CTGCTCAGGTTTCCCTCTCTGGG - Intergenic
1145304504 17:21666002-21666024 GAAGACTGGTTTACCTCTCTGGG - Intergenic
1147895836 17:43750830-43750852 GTGGTCTCGTTTACACCTGTAGG - Intergenic
1148489295 17:48012803-48012825 GTTGCCTGCCTTACCTCTCTTGG - Intergenic
1148582826 17:48755194-48755216 GGGGCATGGTTTTCCTCTCTGGG + Intergenic
1153355896 18:4134881-4134903 CTGGGCTGCTTTTCCTCTCTAGG - Intronic
1155092672 18:22526803-22526825 ATGGTCTGGATTACTTGTCTTGG - Intergenic
1155786834 18:29912994-29913016 GAGATCTGGTTTTCCTTTCTAGG - Intergenic
1157478479 18:48037968-48037990 GTGCTCTGGCTTATCTCCCTCGG + Intronic
1158889245 18:61858149-61858171 GTAGTTTGGTATAACTCTCTGGG + Intronic
1159585237 18:70277671-70277693 GGGGTTTGTTTTACTTCTCTAGG - Intergenic
1160897364 19:1408893-1408915 GTGGTCTGGTGTAAATTTCTCGG + Intronic
926730126 2:16030342-16030364 CTGATCTGGTTAACCTCGCTGGG + Intergenic
927210504 2:20636210-20636232 GTGGGCTTGTTGATCTCTCTTGG - Intronic
937376103 2:121336783-121336805 GTGTTCTGGAATCCCTCTCTAGG - Intergenic
940737829 2:157473035-157473057 GGGTTCTGGATTACTTCTCTGGG + Intronic
947060758 2:226162529-226162551 GTGGTGTTGTCTACCTCTTTAGG + Intergenic
948190950 2:236058113-236058135 GTGGTGTGTTTTAACTCTCTAGG + Intronic
1171529774 20:25845386-25845408 GAAGACTGGTTCACCTCTCTGGG - Intronic
1178690864 21:34748431-34748453 GTGGCCAGGTGTCCCTCTCTCGG + Intergenic
1181925827 22:26357850-26357872 GTGGTGTGGTTTATGTCTTTGGG - Intronic
956231268 3:67019185-67019207 GCGGTTTAGTTTTCCTCTCTGGG + Intergenic
958901412 3:99891424-99891446 GTGCTTTGCTTTACCTTTCTAGG + Intronic
962826162 3:139102325-139102347 CTGGTCTGATTTACATCACTGGG - Intronic
965692754 3:171375132-171375154 GTGGACAGGATTACCTCCCTTGG + Intronic
965896264 3:173580357-173580379 GTGCTCAGGTTTACCAATCTTGG + Intronic
968824827 4:2887496-2887518 GTGGACTGGGCTTCCTCTCTCGG + Intronic
970492706 4:16591212-16591234 AGGGTCTGGTTTACTTCTATTGG + Intronic
977863287 4:101993032-101993054 GTGGTCTGGATTAGCTGTCCAGG - Intronic
978744269 4:112174245-112174267 GTTTTCTGGGTTACCTCTCCTGG - Intronic
981067132 4:140497691-140497713 GTGGTCTGGGTTACATCACCAGG - Intronic
983528855 4:168788978-168789000 GGATTCTGGTTTACCTCTCAAGG - Intronic
984863225 4:184257903-184257925 GTGGTCTGGTTGGCCTGACTTGG + Intergenic
992627218 5:78647424-78647446 TTACTCCGGTTTACCTCTCTGGG + Intronic
995037619 5:107553063-107553085 GTGGTTAGGATTACCCCTCTGGG - Intronic
998320954 5:141230692-141230714 TTGGTCTTGCTTATCTCTCTGGG - Intergenic
998876728 5:146607689-146607711 TTGGTCTGTTTTTCCTGTCTGGG - Intronic
999214922 5:149924767-149924789 AGGGTCAGGTTTACATCTCTGGG - Intronic
1000988974 5:167892426-167892448 GAGGAGTGGTTTTCCTCTCTTGG + Intronic
1003994916 6:11530492-11530514 GTGGTCTGGATGAATTCTCTAGG + Intergenic
1007742999 6:44024136-44024158 CTGGTCTTGCTGACCTCTCTTGG - Intergenic
1008691902 6:53988426-53988448 GTGGTCAAGGTTTCCTCTCTTGG + Intronic
1011134949 6:84090060-84090082 GTGAGTTGCTTTACCTCTCTGGG + Exonic
1015965099 6:138690076-138690098 TTGGACTGGATTTCCTCTCTGGG + Intronic
1016042309 6:139443964-139443986 GTGACTTGGTTTACCTCTCCAGG - Intergenic
1021752233 7:23813896-23813918 GTGGTGTGGTTTTCCTTTGTTGG + Intronic
1022259875 7:28693899-28693921 GTGACTTGGTTTACCTTTCTTGG - Intronic
1023867380 7:44244616-44244638 GTGGTCTGTTTTGTCTCTTTGGG - Intronic
1025302206 7:57826794-57826816 GAAGACTGGTTCACCTCTCTGGG + Intergenic
1031038035 7:116809167-116809189 GTGCACTGGGTTATCTCTCTTGG + Intergenic
1031814134 7:126411508-126411530 GTGGAATGGTTAACATCTCTGGG + Intergenic
1032775923 7:135112617-135112639 GTGCCCTGGTTTATCTCTATAGG + Intronic
1039838290 8:41275355-41275377 GTGGTCTGGTATCTGTCTCTGGG - Intronic
1040944768 8:52873175-52873197 GTGGTCTGATTCTCCTCCCTTGG - Intergenic
1042693347 8:71528259-71528281 GTGTTCTGGTGTAGCTCACTTGG - Intronic
1042943558 8:74132033-74132055 GTGGAGTTGGTTACCTCTCTCGG - Intergenic
1044331399 8:90924101-90924123 ATGGCCTGGTTTTTCTCTCTGGG - Intronic
1056709053 9:88975977-88975999 GTTGCCCGGTTTACCTCCCTCGG - Intergenic
1056848266 9:90058896-90058918 GAGGTCGGGATGACCTCTCTGGG - Intergenic
1057612968 9:96563055-96563077 GTGGTCTTTTCTACCACTCTTGG - Intronic
1186691827 X:11985746-11985768 GTGGCCTGGTAGAACTCTCTGGG + Intergenic
1191663883 X:63678005-63678027 TTGGTTTGGTTTACATCTTTGGG + Intronic
1195706704 X:107742767-107742789 GTGGGCTGGTTAAACTGTCTGGG - Intronic