ID: 1108201946

View in Genome Browser
Species Human (GRCh38)
Location 13:48053001-48053023
Sequence GGGACTAAAGGGCTGGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 802
Summary {0: 1, 1: 0, 2: 4, 3: 75, 4: 722}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108201936_1108201946 2 Left 1108201936 13:48052976-48052998 CCATGTTGGGCAAGAACCATACT 0: 1
1: 0
2: 0
3: 4
4: 99
Right 1108201946 13:48053001-48053023 GGGACTAAAGGGCTGGGGGATGG 0: 1
1: 0
2: 4
3: 75
4: 722

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108201946 Original CRISPR GGGACTAAAGGGCTGGGGGA TGG Intergenic
900127720 1:1075816-1075838 GGGACTCAAGAGCTGGGGAGGGG + Intergenic
900244077 1:1629763-1629785 GGGAGGGAAGGGGTGGGGGACGG - Intronic
900361570 1:2291600-2291622 GAGACTGAGGGGGTGGGGGAGGG - Intronic
900512077 1:3065515-3065537 GGGCCTGAGGGGCTGGGGGTAGG + Intergenic
900532407 1:3161087-3161109 GAGAGGAAAGGGCTGGGGCAGGG - Intronic
900904584 1:5544408-5544430 GGGGGTAGAGGGCTGGGGGAGGG + Intergenic
901176563 1:7304043-7304065 AGTTCTCAAGGGCTGGGGGAGGG + Intronic
901387633 1:8921527-8921549 GGAACTAAAGGCCTGGAGGCTGG - Intergenic
901510977 1:9717909-9717931 GGGACCGCAGAGCTGGGGGAAGG + Intronic
902465982 1:16619118-16619140 GGGACAAAGGGCTTGGGGGATGG + Intergenic
902508709 1:16954186-16954208 GGGACAAAGGGCTTGGGGGATGG - Intronic
902598826 1:17527194-17527216 GGGAATGCAGGGGTGGGGGAAGG + Intergenic
902822178 1:18950108-18950130 TGGGAGAAAGGGCTGGGGGATGG + Intronic
903018905 1:20379908-20379930 GGGGCCAAGGGGCTGGGGGGTGG - Intergenic
903267591 1:22167247-22167269 GGGATTGAAGGCCTGGAGGAAGG - Intergenic
903325028 1:22564424-22564446 GGGAGGAGAGGGCTGGGGGATGG + Intronic
903426194 1:23256233-23256255 GAGAAAAAAGGGCTGGGGGAAGG - Intergenic
903527054 1:23998985-23999007 GGGAGTAGGGGGTTGGGGGATGG + Intergenic
903780149 1:25815702-25815724 GGCACTCTAGGGCTGGAGGAGGG - Exonic
903833235 1:26187253-26187275 GGGTGTGATGGGCTGGGGGATGG + Intronic
903867510 1:26410230-26410252 GGAGCTCAAGGGCTGGGGGAGGG + Intergenic
904311602 1:29632824-29632846 GGGGCTGAGGGGCTGGGGGCTGG - Intergenic
904334232 1:29786571-29786593 GGGTCAAAATGCCTGGGGGAAGG + Intergenic
904347769 1:29884484-29884506 GAGAGAAAAGGGCTGGGGAAAGG - Intergenic
904433444 1:30479531-30479553 GGGAAGAGTGGGCTGGGGGAGGG - Intergenic
904433504 1:30479671-30479693 GGGAAGGGAGGGCTGGGGGAGGG - Intergenic
904535796 1:31198698-31198720 GGGAGCGAAGGGCAGGGGGAAGG - Intronic
904618669 1:31763096-31763118 GGGAGGATAGGGATGGGGGATGG + Intronic
904799815 1:33084267-33084289 GGGTCTCAAGGGATGAGGGAGGG + Intronic
904816605 1:33207091-33207113 GGGAGTGGGGGGCTGGGGGAGGG - Intergenic
905845709 1:41229590-41229612 GAGGGTAGAGGGCTGGGGGAGGG + Intronic
906240871 1:44241491-44241513 AGGAGTAATGGGCTGGGGGTGGG - Intronic
906353469 1:45083024-45083046 GGTGCTACAGGCCTGGGGGATGG + Intronic
906370439 1:45248591-45248613 GGGTCTAATGGTCTGAGGGATGG + Intronic
906549758 1:46654681-46654703 GGGGGTGGAGGGCTGGGGGAGGG - Intronic
907286110 1:53380963-53380985 GGAAGGAAGGGGCTGGGGGAGGG - Intergenic
907426052 1:54379983-54380005 GGGACAATGGGGCTGGAGGAGGG + Intronic
907798609 1:57742379-57742401 GGGATCAAAAGGATGGGGGATGG + Intronic
907945982 1:59137137-59137159 GTGGCTCAAGGGCTGGGGGCTGG + Intergenic
908524728 1:64976756-64976778 AGGATTAAAAGGCTGAGGGAAGG - Intergenic
909433401 1:75615342-75615364 GGGACGAAGGGGCGGAGGGAGGG + Intergenic
909601721 1:77468021-77468043 GGGGCTTAAGTGCTGGGGTAGGG + Intronic
909700856 1:78521077-78521099 GTGTCTATAGAGCTGGGGGATGG - Intronic
910146539 1:84086418-84086440 GGGACGAAAGGCATGTGGGAGGG - Intronic
910825951 1:91407207-91407229 GGGGGTGAGGGGCTGGGGGAAGG + Intergenic
910924781 1:92387148-92387170 GGGACTGAAGGACTGGGAGATGG - Exonic
911366721 1:96947537-96947559 GGGGATGAGGGGCTGGGGGAGGG - Intergenic
911450052 1:98050564-98050586 GGAAATATAGGGATGGGGGAGGG + Intergenic
911664546 1:100538813-100538835 CAGAATAATGGGCTGGGGGAGGG - Intronic
911678364 1:100685069-100685091 GGGACTAGGGGGCTAGGGGAGGG - Intergenic
911811756 1:102291262-102291284 GGGACTGGAGGTCTAGGGGAGGG + Intergenic
912171172 1:107101251-107101273 AGGACTAATGGGGTAGGGGAGGG + Intergenic
912587686 1:110781404-110781426 AGGACCAAGGGGCTGGAGGAAGG - Intergenic
912615461 1:111095827-111095849 GGGGCTGGGGGGCTGGGGGAGGG + Intergenic
912797232 1:112700595-112700617 GGGACAGGAAGGCTGGGGGAGGG + Exonic
912872255 1:113319024-113319046 GGGGCTGGGGGGCTGGGGGAGGG + Intergenic
912978212 1:114348564-114348586 GAGCCTGAAGGGCTGGGGGCTGG + Intergenic
913187176 1:116379465-116379487 GGGACTGGAGGGCTAAGGGATGG - Intronic
913572755 1:120137799-120137821 GGGAATAAAGGGGTGGGGTATGG + Intergenic
913668131 1:121069364-121069386 GAGACTGAAAGGCTGGAGGAGGG + Intergenic
914019878 1:143856805-143856827 GAGACTGAAAGGCTGGAGGAGGG + Intergenic
914263652 1:146019866-146019888 GGGACTAGGGGGTTGGGGGCTGG - Intronic
914294020 1:146302583-146302605 GGGAATAAAGGGGTGGGGTATGG + Intergenic
914555064 1:148753366-148753388 GGGAATAAAGGGGTGGGGTATGG + Intergenic
914658374 1:149764710-149764732 GAGACTGAAAGGCTGGAGGAGGG + Intergenic
915625516 1:157111850-157111872 GGGATGCAAGGGCTGGGGGAGGG + Intergenic
916223837 1:162470189-162470211 GGAACAAGAAGGCTGGGGGAAGG - Intergenic
917025000 1:170631807-170631829 GGGACGACGGGGATGGGGGACGG - Intergenic
917559927 1:176139793-176139815 GGAACTACTGGGGTGGGGGAAGG + Intronic
918129050 1:181608908-181608930 GAGCCTACAGGGCTGGGGCAGGG + Intronic
918273307 1:182924815-182924837 GGGAAGAGAGGGGTGGGGGAAGG + Intronic
918470285 1:184865443-184865465 GGGACTATAGAGGTGGGGGAAGG + Intronic
919739211 1:200972335-200972357 GGGACTGCAGGGCTGGGGAGGGG + Intronic
919879989 1:201894991-201895013 GGCCCTAGAGGGCTGGAGGAAGG + Intergenic
919887858 1:201947842-201947864 GGGACTGAAGGGCAGAAGGAAGG + Intergenic
920225211 1:204433579-204433601 GGAACTGAAGGGCTGGAGCAGGG + Intronic
922550013 1:226488017-226488039 GGGAATAAAGAGCTGGGGACTGG - Intergenic
922601155 1:226854905-226854927 GGGTTTGGAGGGCTGGGGGAGGG + Intergenic
922992303 1:229924744-229924766 GGCACTGAAGGTCTAGGGGAAGG + Intergenic
923612810 1:235510286-235510308 GTCATTAAAGGGCTGGGGTAAGG - Intergenic
924014995 1:239711602-239711624 TGGACTAAAGGTTTGGTGGAAGG - Intronic
1064206749 10:13330976-13330998 GGGGGTAGGGGGCTGGGGGAGGG - Intronic
1064407594 10:15078085-15078107 GGGACTAGGGGGTTAGGGGAGGG - Exonic
1065157493 10:22885490-22885512 GGGGGTAGGGGGCTGGGGGAGGG + Intergenic
1065160946 10:22920978-22921000 GGGGTTGAGGGGCTGGGGGAGGG - Intergenic
1066334580 10:34463041-34463063 GGGAGGAAAGGGAAGGGGGAGGG + Intronic
1066608571 10:37210104-37210126 GGGGATGAGGGGCTGGGGGAGGG - Intronic
1066965000 10:42255258-42255280 GGGGGTGGAGGGCTGGGGGAGGG - Intergenic
1067286594 10:44911773-44911795 GGGACCAGAGGGCTGGGTGCTGG + Intronic
1067346459 10:45441986-45442008 GTCACTAATGGGCTGGGGAAAGG - Intronic
1067441397 10:46310953-46310975 AGGACTGCAGGGCTGAGGGATGG + Intronic
1067899590 10:50225162-50225184 GGGACTAAAGGCATGGTGCAAGG - Intronic
1067996721 10:51281487-51281509 GGAACTGCAAGGCTGGGGGAGGG + Intronic
1069090477 10:64194174-64194196 GGGGGTGAAGGGCAGGGGGAGGG + Intergenic
1069260470 10:66387945-66387967 GGGGATGGAGGGCTGGGGGAGGG + Intronic
1069531112 10:69220245-69220267 GGGACCAAAGGGGTGGGGTGGGG + Intergenic
1069712804 10:70500736-70500758 GGGATTATAGGGGTGGGGGAAGG + Intronic
1069734007 10:70639621-70639643 GGGGGTGAGGGGCTGGGGGAGGG - Intergenic
1069754406 10:70764339-70764361 GAGACTGAAGGCTTGGGGGAAGG + Intergenic
1070040224 10:72771190-72771212 GGGATTAGGGGGCTAGGGGAGGG - Intronic
1071334743 10:84591378-84591400 GGGATTAAGGGGCTGGGGCTGGG - Intergenic
1072396606 10:95049625-95049647 TGGACTATAGGGCTCTGGGATGG + Intronic
1072560355 10:96567574-96567596 TGGAGGAAAGGGCTGGGGGATGG - Intronic
1073070592 10:100790854-100790876 AGGCATAGAGGGCTGGGGGAGGG + Intronic
1073969817 10:109034656-109034678 GTGAATCAAGGGCTGGGGAAAGG - Intergenic
1075259702 10:120952015-120952037 GGGAGAAAAGGGTGGGGGGATGG + Intergenic
1075483286 10:122800136-122800158 TGGGCAAAAGGGCTGGGGGCAGG + Intergenic
1075621054 10:123928762-123928784 GGGACTAAATGGCTGTGGGATGG - Intronic
1075664678 10:124221953-124221975 GGGAGTGAGGGGCTGGGCGACGG - Intergenic
1076616556 10:131759052-131759074 GAGTCTCCAGGGCTGGGGGAGGG - Intergenic
1076668884 10:132108337-132108359 AGGATGAAAGGGCTGGGAGAGGG - Intronic
1077063838 11:629732-629754 GGAGCTGAAGGGATGGGGGAAGG - Intergenic
1077237336 11:1488105-1488127 GGCACCACAGGGCTGTGGGATGG - Intronic
1077358083 11:2127790-2127812 GGGACTGCAGGGCTGGGGGAGGG + Intergenic
1077371155 11:2182229-2182251 GGGAAGAAAGGGCTGTGGGCAGG + Intergenic
1077377824 11:2213627-2213649 GGGTGTCAGGGGCTGGGGGAGGG - Intergenic
1077906469 11:6538550-6538572 AGGACTACAGTGGTGGGGGAGGG + Intronic
1078559968 11:12363016-12363038 GGGTCAGAGGGGCTGGGGGAAGG - Intergenic
1078579319 11:12526344-12526366 GGGAAAGAAGGGGTGGGGGAAGG - Intronic
1078648571 11:13166038-13166060 GGAAGTAAAGGGCTTTGGGAAGG - Intergenic
1079367734 11:19823770-19823792 GGGACTCGGGGGCTAGGGGAAGG + Intronic
1079611608 11:22439742-22439764 GGGAGTGGAGGGCTAGGGGAGGG - Intergenic
1080977704 11:37362611-37362633 GGGAGTGGAGGGCTAGGGGAAGG + Intergenic
1081005674 11:37734618-37734640 GTTAGTCAAGGGCTGGGGGAAGG - Intergenic
1081492690 11:43580058-43580080 GGTACTAATGGGGGGGGGGAGGG + Intronic
1082217748 11:49595222-49595244 GGGGGTAGGGGGCTGGGGGAGGG + Intergenic
1082723649 11:56709553-56709575 GGGAGTGGTGGGCTGGGGGAGGG - Intergenic
1083266748 11:61550432-61550454 GGGGCCAGAGGGCAGGGGGAGGG + Intronic
1083609207 11:63997248-63997270 GAGAGTAAAGGGGAGGGGGACGG - Intronic
1084268431 11:68016740-68016762 GAGCCCAATGGGCTGGGGGAAGG - Intronic
1084515648 11:69636938-69636960 GTGCCTTAAGGGCTGGGGGCAGG - Intergenic
1084822728 11:71704558-71704580 GGGACTAAAGAGGAGAGGGATGG + Intergenic
1084970548 11:72769083-72769105 AGGGGTAAAGGGCTGGGGGGTGG + Intronic
1085614613 11:77986837-77986859 GGGAGTGGGGGGCTGGGGGAGGG + Intronic
1085871155 11:80350695-80350717 GGGACTCAATGGCTTTGGGAAGG + Intergenic
1086294473 11:85349552-85349574 GAGGGTAGAGGGCTGGGGGAGGG - Intronic
1087311676 11:96551013-96551035 GGGGGTAGGGGGCTGGGGGAGGG + Intergenic
1088211383 11:107460665-107460687 GGGGGTGAGGGGCTGGGGGAGGG - Intergenic
1088370606 11:109084532-109084554 GGGAGTGGGGGGCTGGGGGAGGG - Intergenic
1088679289 11:112225721-112225743 GGGAGTAGGGGGCTGGGGGAGGG + Intergenic
1088919542 11:114251186-114251208 GGGAACAAAGAGCTGGAGGAGGG - Intergenic
1089248851 11:117143287-117143309 GGGACTGCGGGGCTGGGGGAGGG + Intergenic
1089461379 11:118656236-118656258 GGCACCAGAGGGCTGGGGGCAGG - Intronic
1090002785 11:122977060-122977082 GGGACTCTGGGGATGGGGGATGG + Intergenic
1090232822 11:125121081-125121103 GAAACTAGAGGGCTTGGGGATGG + Intergenic
1091078173 11:132640842-132640864 TGCACTAAAGGGCAGGGAGAGGG + Intronic
1091239677 11:134044034-134044056 GGCACTGATGGGCTGGGTGAGGG - Intergenic
1091422156 12:351200-351222 GGGAGTAGGGGGCTAGGGGAGGG - Intronic
1092639450 12:10487665-10487687 GGGAGTGGAGGGCTAGGGGAAGG + Intergenic
1092721110 12:11441488-11441510 GGGTGTCAAGGGCTGGGGGAAGG + Intronic
1092798733 12:12141183-12141205 AAGAGGAAAGGGCTGGGGGAGGG + Intronic
1093091825 12:14930015-14930037 GGGGATAGGGGGCTGGGGGAGGG + Intronic
1094151467 12:27288841-27288863 GGGAGTAAATGGCAGGGGGGAGG - Intronic
1095957825 12:47816894-47816916 TGGACTCGCGGGCTGGGGGAAGG - Intronic
1096489352 12:52005281-52005303 GGGCCTAGAGGACTGGGGGTGGG + Intergenic
1096865307 12:54559231-54559253 GGGGGTAAAGGGGTGGGGGTGGG - Intronic
1096958155 12:55547900-55547922 GGGGCTGGAGGGCTTGGGGATGG - Intergenic
1097297310 12:57980568-57980590 GGGAGTAGGGGGCTAGGGGAGGG + Intergenic
1097926316 12:65132033-65132055 GGGACTAAATGTTTGGGGGAGGG + Intergenic
1098685089 12:73409859-73409881 GGGGGTGAAGGGCTGGGGGAGGG - Intergenic
1099010406 12:77284786-77284808 GGGAGTGAAGGGGTGGAGGAAGG + Intergenic
1099398245 12:82168983-82169005 GGGGATAGGGGGCTGGGGGAGGG - Intergenic
1100130573 12:91488072-91488094 GGGGGTGAGGGGCTGGGGGAGGG + Intergenic
1100713729 12:97283946-97283968 GGTACTCTAGGGCTGAGGGAGGG - Intergenic
1100772603 12:97939914-97939936 GTGACTCAATGACTGGGGGATGG + Intergenic
1100797660 12:98199303-98199325 GGGGCTGGGGGGCTGGGGGAGGG - Intergenic
1101557896 12:105827767-105827789 GGGACTGGGGGACTGGGGGAGGG + Intergenic
1101830608 12:108253643-108253665 AGGACAACAGGGGTGGGGGAAGG - Intergenic
1101909341 12:108850301-108850323 GGGGGAAAAGGGCTTGGGGAGGG + Intronic
1102235116 12:111289617-111289639 CGGTGTAAAGGGCTGGGAGAGGG + Intronic
1102720783 12:115014140-115014162 GGGAGTAAAGGGAGGGAGGATGG + Intergenic
1103363328 12:120366833-120366855 GAGATTTAGGGGCTGGGGGATGG - Intronic
1103403896 12:120661322-120661344 AGGATGAAAGGGCTGGGGGTTGG - Intronic
1103480391 12:121246814-121246836 GGGGCTGGGGGGCTGGGGGAGGG - Intronic
1103972749 12:124682289-124682311 GGAAGGACAGGGCTGGGGGAGGG + Intergenic
1104076389 12:125393541-125393563 GGGGTAAAAGGGCTGGGGGGTGG + Intronic
1104928256 12:132324902-132324924 GGGGCTGGAGGGCTTGGGGAAGG - Intronic
1104933153 12:132351028-132351050 GGGACTGCAGGGCTTGGGGAGGG + Intergenic
1104963695 12:132499708-132499730 GGGGCTGCAGGGCTGGGGGGTGG + Intronic
1105304257 13:19158038-19158060 GGGACTAGAGGGCTTGGGCCAGG - Intergenic
1105818871 13:24062332-24062354 AGGACTAAAGGGCTGGGGGCAGG + Intronic
1105829972 13:24155523-24155545 GGGACTGATGGGCAGTGGGATGG + Intronic
1105836640 13:24217868-24217890 GTGACTTGAGGGTTGGGGGAAGG - Intronic
1107058509 13:36131209-36131231 GGGGCTGCAGGGCTGGGGGGCGG + Exonic
1107792031 13:44012379-44012401 GGGACCACAGGGCAGGGGCAAGG - Intergenic
1108201946 13:48053001-48053023 GGGACTAAAGGGCTGGGGGATGG + Intergenic
1108254098 13:48594213-48594235 GGGACTGAATGGGTGGGGGAAGG - Intergenic
1109082246 13:57919329-57919351 TGGACTCTAGGGTTGGGGGAAGG - Intergenic
1109626104 13:64977316-64977338 GGGAGTGAAGGGCTAGGGGAGGG - Intergenic
1111493856 13:89022414-89022436 GGGGCTGGGGGGCTGGGGGAGGG - Intergenic
1111933190 13:94532636-94532658 GGGAGTCAGGGGCTAGGGGAGGG + Intergenic
1112073349 13:95880033-95880055 GGGGCCAGAGGGCTAGGGGAAGG - Intronic
1112508513 13:99989581-99989603 GAGACAAAAGGGCTAGGGGGTGG - Intergenic
1112744627 13:102512648-102512670 TGGTCTAAAGGACTGGGAGAAGG - Intergenic
1113409277 13:110070219-110070241 GGGATTAGAGGGGTGGGGAAGGG - Intergenic
1113409291 13:110070252-110070274 GGGATTAGAGGGCTGGGGAAGGG - Intergenic
1113898694 13:113783732-113783754 GGGGCTAAAGGCTTGGGGGTAGG + Intronic
1114046779 14:18882299-18882321 GGGAGTAAAGGAGAGGGGGATGG - Intergenic
1114117434 14:19637147-19637169 GGGAGTAAAGGAGAGGGGGATGG + Intergenic
1114264372 14:21063758-21063780 TGGAGCAAAGGGCTGGGGGTAGG + Intronic
1114494558 14:23123715-23123737 GGGAGTAAGGGGGTGGTGGAGGG - Intergenic
1114543806 14:23483517-23483539 GGCAGTAGAGGGCTGGGGAAAGG - Intronic
1115511890 14:34145962-34145984 GGGGCTCAGGGGCTAGGGGAGGG + Intronic
1115647997 14:35383698-35383720 GGGACAAGATGGCTGGTGGATGG + Intergenic
1115947373 14:38677154-38677176 GGGGGTGGAGGGCTGGGGGAGGG + Intergenic
1115958680 14:38810339-38810361 GGGAGTGGGGGGCTGGGGGAGGG - Intergenic
1116051023 14:39803308-39803330 GGGGCTGGGGGGCTGGGGGAAGG - Intergenic
1116754435 14:48928056-48928078 GGGGGTAGGGGGCTGGGGGAGGG + Intergenic
1117252708 14:53952584-53952606 GGGTGAAAAGGGGTGGGGGAGGG + Intronic
1117261009 14:54033409-54033431 GTGGCAGAAGGGCTGGGGGAGGG - Intergenic
1117538437 14:56723786-56723808 GGGGATAAAGGGATGGGGCAGGG + Intronic
1117639062 14:57777630-57777652 GGGGGTGAGGGGCTGGGGGAGGG + Intronic
1117893183 14:60449036-60449058 GGGAGTAGGGGGCTGGGGGAGGG + Intronic
1117955319 14:61118872-61118894 GGGAAAAAAAGGCGGGGGGAGGG - Intergenic
1118531503 14:66711731-66711753 GGGGGTAGGGGGCTGGGGGAGGG - Intronic
1118719314 14:68583000-68583022 GGGGCTAGGGGGCTAGGGGAGGG + Intronic
1118778998 14:68993721-68993743 GGGACTGAATGGCTGGGGAGTGG - Intergenic
1119075199 14:71631013-71631035 GGGGCTGGGGGGCTGGGGGAGGG - Intronic
1119566180 14:75631188-75631210 GGGGCTAAAGGGCGGCGAGAGGG - Intronic
1119715166 14:76853959-76853981 GAGACTGAGGGGCTGGGGGAAGG - Intronic
1119852195 14:77874146-77874168 GGGACAAGAGGGTTGGAGGAAGG + Intronic
1120402146 14:84045300-84045322 GGGAATAAAGAGCTGGGGGAAGG - Intergenic
1122032948 14:98926876-98926898 GGGGCTGGGGGGCTGGGGGAGGG - Intergenic
1122654101 14:103245672-103245694 GGGGGTAAAGGGCAAGGGGAGGG - Intergenic
1122791424 14:104185620-104185642 GGGAGTAAAGGGATGGGGTGGGG + Intergenic
1122899125 14:104774897-104774919 GGGGCTGAAGGGCTGGGGCCAGG - Intronic
1123118999 14:105908420-105908442 GGGGAGAAAGGGCTGGAGGAGGG + Intergenic
1123148579 14:106158645-106158667 GGAGGTAAAGGGCTAGGGGAGGG - Intergenic
1124028911 15:25991408-25991430 AGGACTGGAGGGCTGGGAGAGGG - Intergenic
1124242179 15:28037805-28037827 GGGAGGGAAGGGCTGGGGGATGG - Intronic
1124332627 15:28833145-28833167 GGGAGAGAAGAGCTGGGGGACGG - Intergenic
1125512793 15:40301912-40301934 GGGACAAGAATGCTGGGGGATGG + Intronic
1126128637 15:45319161-45319183 GGGGCTGGGGGGCTGGGGGAGGG + Intergenic
1126401128 15:48271917-48271939 GGAACAAAAGGGATGGAGGAGGG + Intronic
1126839709 15:52705355-52705377 GGGAGTGGGGGGCTGGGGGAGGG + Intronic
1127039765 15:54961864-54961886 GGGACAAAAAGGAAGGGGGAGGG - Intergenic
1127212771 15:56791516-56791538 GGGACTTCTGGGGTGGGGGAAGG - Intronic
1127268426 15:57379641-57379663 GGCACTAAAGGGCGGTGGCATGG + Intronic
1127328461 15:57917044-57917066 GGGACGAGTGGGCTGGAGGAAGG + Intergenic
1127553063 15:60060247-60060269 GGAACAAAAAGGCTGAGGGAGGG - Intronic
1127884644 15:63189019-63189041 GTGACTGAGGGGCTGCGGGAGGG + Intergenic
1127983443 15:64050629-64050651 GGGAGGAAGGAGCTGGGGGATGG + Intronic
1128539705 15:68518011-68518033 TGGAACACAGGGCTGGGGGAAGG + Intergenic
1129127342 15:73453968-73453990 GGGAGTGGGGGGCTGGGGGAGGG + Intronic
1129188105 15:73922805-73922827 GGGACTAATGGGGTTGGGGGTGG - Intergenic
1129604991 15:77020525-77020547 GTGACTAAATGGATGGAGGATGG - Intronic
1130995109 15:88899197-88899219 GGGGCTTAGGGGCTGGGGCAGGG + Exonic
1131233341 15:90675350-90675372 GGTACTTAAGGGCAGGGAGAAGG - Intergenic
1131414760 15:92244961-92244983 AGGACTAAGGGGTTGGTGGAAGG - Intergenic
1131538072 15:93253904-93253926 GGGAACAAAGGGCTTGGAGAAGG + Intergenic
1131645633 15:94339156-94339178 GAGATTAAAGGGCTCGGAGATGG - Intronic
1131838585 15:96414146-96414168 GGGAGGAAAGGGGAGGGGGAAGG + Intergenic
1132343332 15:101091690-101091712 GGGACTAAAGGGCAGGAGAGAGG + Intergenic
1132614858 16:835409-835431 GGGCCTGAAGGGGAGGGGGAGGG + Intergenic
1132676678 16:1123961-1123983 GGCACTGCAGGCCTGGGGGAGGG + Intergenic
1132806671 16:1778186-1778208 GGCACCAAGGAGCTGGGGGAGGG - Exonic
1133918944 16:10134477-10134499 GGGGGTAGGGGGCTGGGGGAGGG + Intronic
1134446832 16:14337428-14337450 GGGACTAAGGGGCTGACGGCAGG - Intergenic
1136412661 16:30086159-30086181 GGGGCTCCAGGGCTGGGGGAAGG + Exonic
1136429114 16:30186734-30186756 GGGACCCAGGGGCTGGGAGAGGG + Intronic
1136618652 16:31413476-31413498 GGGAATCAGGGGCTGGGGGAAGG - Intronic
1136681637 16:31968994-31969016 GGAGGTAAAGGGCTAGGGGAGGG + Intergenic
1136730687 16:32409258-32409280 GGGGGTGGAGGGCTGGGGGAGGG - Intergenic
1136781945 16:32910492-32910514 GGAGGTAAAGGGCTAGGGGAGGG + Intergenic
1136887848 16:33943356-33943378 GGAGGTAAAGGGCTAGGGGAGGG - Intergenic
1137344071 16:47638044-47638066 GGGGATAAGGGGCTGGGGAATGG - Intronic
1137573104 16:49579390-49579412 GGGACTAAGGAGCGGAGGGAAGG - Intronic
1137794597 16:51205029-51205051 GGGATAAAAGGGATGGGGCATGG - Intergenic
1138164684 16:54790095-54790117 GGGAGTGGGGGGCTGGGGGAGGG - Intergenic
1138769695 16:59648942-59648964 GGGGCTGGGGGGCTGGGGGATGG - Intergenic
1139455040 16:67067623-67067645 GGGACCACAGAGCTGGGGAATGG - Intronic
1141606684 16:85158114-85158136 GAGACTAGAGGGCCAGGGGAGGG - Intergenic
1141688744 16:85584890-85584912 GGGGCTGGAGGGGTGGGGGAAGG - Intergenic
1141693895 16:85611268-85611290 GGGAGTCACGGGCGGGGGGAGGG - Intergenic
1141980581 16:87547609-87547631 GGGACTGAAGGGCTCTGGGGAGG + Intergenic
1141997691 16:87645725-87645747 GGGCCTTTAGGGCTGGAGGAAGG + Intronic
1142006380 16:87691308-87691330 GGGAATGAAGGGCTGTGGGACGG + Intronic
1202995710 16_KI270728v1_random:108011-108033 GGGGGTGGAGGGCTGGGGGAGGG + Intergenic
1203022397 16_KI270728v1_random:420353-420375 GGGGGTGGAGGGCTGGGGGAGGG + Intergenic
1203084601 16_KI270728v1_random:1174482-1174504 GGAGGTAAAGGGCTAGGGGAGGG + Intergenic
1142690731 17:1604978-1605000 GGGCCTCGAGGGCTGGCGGAGGG + Intronic
1142897304 17:2989897-2989919 GGAACTAAAGGAAAGGGGGATGG - Intronic
1143447688 17:7018763-7018785 AGGAGAAAAGGGCTGAGGGAAGG - Intergenic
1143524806 17:7465990-7466012 GGGTCTACAGGGCTGGGAGCTGG - Exonic
1144761942 17:17711898-17711920 GGCACTAAAGGGCTGGGCCTGGG - Intronic
1144839792 17:18178872-18178894 GGTACTGGAGGGCTGGGGGCTGG - Exonic
1145103669 17:20097234-20097256 GAGACCAAAGGGATGGGGGGAGG - Intronic
1145243369 17:21252574-21252596 GGGAGTGAGGGGCGGGGGGATGG - Intronic
1146005711 17:29159317-29159339 GGTAATGAAGGGCTGGGGGCAGG - Intronic
1146667263 17:34713410-34713432 GGGACGGAAGAGCTGGTGGATGG + Intergenic
1146917421 17:36687068-36687090 GGGACAAATGGGCTTGGGGAGGG - Intergenic
1147387847 17:40092229-40092251 GGGTCTGCAGGGCTGGGAGAGGG + Intronic
1147486005 17:40815030-40815052 TGGGGTAGAGGGCTGGGGGAGGG + Intergenic
1148028692 17:44605376-44605398 GGGGCGAAAGGGCTGGGGCCAGG + Intergenic
1148450528 17:47774848-47774870 GAGTCTAAAGGGCTGAAGGAGGG - Intergenic
1148470693 17:47891402-47891424 GGGGGTGGAGGGCTGGGGGAGGG - Intergenic
1148542538 17:48492286-48492308 GGGATTGGGGGGCTGGGGGATGG - Intergenic
1148561168 17:48607288-48607310 GGGAGCATGGGGCTGGGGGACGG + Exonic
1148756496 17:49975799-49975821 TGGCCTGAGGGGCTGGGGGAGGG + Intergenic
1148986045 17:51622213-51622235 AGGGCTGAAGGGTTGGGGGAGGG + Intergenic
1149415616 17:56456754-56456776 GACACTAAAGGGATGGGGGAGGG + Intronic
1149622990 17:58060125-58060147 GGGCCTAAGAGGCTGGGGGAGGG + Intergenic
1149825689 17:59825679-59825701 TGAACTTGAGGGCTGGGGGATGG + Intronic
1149990229 17:61379071-61379093 TGGACTGAGGGGCTGGGGGAGGG + Intronic
1150094662 17:62362988-62363010 GGGGGTGGAGGGCTGGGGGAGGG + Intergenic
1150502171 17:65661246-65661268 GTGACTAGAAGGCTGTGGGAGGG - Intronic
1150637345 17:66923188-66923210 GGGAGTCAGGGGCTGGGGGAAGG - Intergenic
1151067909 17:71172958-71172980 GGGACTCAGGGGAGGGGGGAAGG - Intergenic
1151286358 17:73114411-73114433 GGTATTAAATGGCTGGGGGCTGG - Intergenic
1151360250 17:73584376-73584398 GGTAGAAAAGGGCTGGGTGAGGG + Intronic
1151552182 17:74828503-74828525 GGGATGAGCGGGCTGGGGGAGGG + Intronic
1151983910 17:77529737-77529759 GGGCCTAAAGCCCTGCGGGAAGG - Intergenic
1152779595 17:82220320-82220342 GGGGCCAAGGGGCTGGGGTAGGG + Intergenic
1152813572 17:82393859-82393881 GGCACCAAAGGACAGGGGGAAGG + Intronic
1152820603 17:82435875-82435897 CGGCCAACAGGGCTGGGGGAGGG + Intronic
1153474871 18:5488414-5488436 GGGACTGGGGGGCTAGGGGAGGG + Intronic
1153717301 18:7863341-7863363 GGGGGTGAGGGGCTGGGGGAGGG - Intronic
1154089022 18:11339507-11339529 GGGACTGGAGGGTTGGGGAATGG + Intergenic
1156490606 18:37493668-37493690 GGGACTGCAGAGGTGGGGGAGGG + Intronic
1156512815 18:37655362-37655384 GGGAGTCAAGCTCTGGGGGAAGG + Intergenic
1156925513 18:42573170-42573192 GGGTGTGAGGGGCTGGGGGAGGG + Intergenic
1157318111 18:46610400-46610422 GGGGCTGGGGGGCTGGGGGAGGG + Intronic
1157337025 18:46748071-46748093 GGGGGTGGAGGGCTGGGGGAGGG + Intronic
1157596893 18:48869614-48869636 GGGACTGAGGGGCTTGGGGAGGG + Intergenic
1158130661 18:54149177-54149199 GGGGGTGGAGGGCTGGGGGAAGG - Intergenic
1158923511 18:62224109-62224131 GGGCATGAGGGGCTGGGGGAGGG - Intronic
1159624411 18:70675384-70675406 GTGTGTAAAGGGATGGGGGAAGG + Intergenic
1159775021 18:72594132-72594154 GGGGTTGAAGGGCTAGGGGAGGG + Intronic
1159812964 18:73038986-73039008 GGGAGAAGAGGGATGGGGGAGGG - Intergenic
1160116272 18:76082180-76082202 GGGACTCACGGGCTGGGTGCTGG + Intergenic
1160290021 18:77583721-77583743 GGGGTTGGAGGGCTGGGGGAGGG + Intergenic
1160318415 18:77868689-77868711 CTGACTACAAGGCTGGGGGAAGG + Intergenic
1160606059 18:80050175-80050197 GGGACAACAGGGCAGGGAGAAGG + Intronic
1160769158 19:822464-822486 GAGACAAAAGAGCTGGGGGAGGG + Intergenic
1160789775 19:918047-918069 CTGAACAAAGGGCTGGGGGAGGG + Intronic
1161141425 19:2650540-2650562 GGGGTTAAAGGGCTGGGGACAGG - Intronic
1161419980 19:4171416-4171438 GGGCCAAAAGGGCTGATGGAGGG - Exonic
1161621221 19:5298395-5298417 GGGACAGACAGGCTGGGGGAGGG - Intronic
1161933537 19:7356966-7356988 GGGACCCAAGGGCTGGGGTTAGG + Intronic
1162830662 19:13282318-13282340 GGGAGGGAAGGGTTGGGGGAGGG + Intronic
1162838647 19:13339355-13339377 GGGTGCCAAGGGCTGGGGGAGGG + Intronic
1163021420 19:14482808-14482830 GGGGCCGCAGGGCTGGGGGAGGG + Exonic
1163048607 19:14663929-14663951 GGGAGTGGGGGGCTGGGGGAGGG - Intronic
1163189187 19:15664041-15664063 GGGACTTTGGGGTTGGGGGAAGG - Intergenic
1164134010 19:22394686-22394708 GGGTGTGAGGGGCTGGGGGAAGG + Intronic
1164164797 19:22662074-22662096 GGGTATGAGGGGCTGGGGGAAGG - Intronic
1165027669 19:32973315-32973337 GGGAGGAAAGGGCTGGCAGAGGG - Intronic
1165059249 19:33196797-33196819 GGGACTGAAGGAGTGGAGGAAGG - Intronic
1165229490 19:34377951-34377973 GGGACCAATGGCCAGGGGGATGG - Intronic
1165311630 19:35032037-35032059 GGGAGAAAAGGTCTGGGGGTGGG - Intronic
1165436426 19:35797697-35797719 GGGGCCTGAGGGCTGGGGGAAGG + Intergenic
1166069991 19:40381376-40381398 GGGACTGGAGGTCTGGGGCAAGG - Intronic
1166079276 19:40433837-40433859 GGAATTCAAAGGCTGGGGGAAGG + Intergenic
1166087681 19:40487855-40487877 GGGCCTGAAGGGCTGGGGCAGGG + Intronic
1166094078 19:40529009-40529031 GGGAGATAAGGGCTGGGGAAAGG - Intronic
1166258785 19:41623942-41623964 GGGGCTGCAGGGCTGTGGGAAGG - Intronic
1166343113 19:42150418-42150440 GGGTGGAGAGGGCTGGGGGAGGG + Intronic
1167635154 19:50649934-50649956 GGGCCTGATGGGCTGTGGGAGGG - Intronic
1168184843 19:54693643-54693665 GGGGCTGGGGGGCTGGGGGAGGG - Intronic
1168599656 19:57707688-57707710 GGGAACAAAGAGCAGGGGGAAGG - Intronic
925037433 2:700319-700341 GGGAGTAAGGGGCTAGGGGAGGG + Intergenic
925153696 2:1634697-1634719 GGGACTAGAGAGAGGGGGGAAGG + Intronic
926277563 2:11416349-11416371 GTGACTCAAGAGCTGGGGGTTGG + Intergenic
926732631 2:16048525-16048547 GGGCCTTAAGGGCTTGGGGAGGG + Intergenic
926735759 2:16072205-16072227 GGGAGTGCAGGGCTGGGAGAGGG + Intergenic
927154475 2:20213607-20213629 GGGCAGACAGGGCTGGGGGAGGG - Intronic
927780873 2:25938616-25938638 GGGAGAGAAGGGTTGGGGGAAGG + Intronic
928272498 2:29869051-29869073 GTGACTTAATGGCTGGGGGATGG - Intronic
928518354 2:32064247-32064269 GTAACTAGGGGGCTGGGGGAGGG + Intronic
929025195 2:37594333-37594355 GGGGGTAGGGGGCTGGGGGAGGG - Intergenic
929168261 2:38905364-38905386 GGGGCTGGAGGGCTGGGGAAGGG + Intronic
929598803 2:43192326-43192348 AGGACTGGAGGTCTGGGGGAGGG - Intergenic
930056298 2:47254667-47254689 GGAACTGAAGTGCTGGTGGAAGG - Intergenic
930366493 2:50446337-50446359 GGGAGGAAGGGACTGGGGGAAGG - Intronic
930710833 2:54549788-54549810 GGGACTAAAAGGTGAGGGGAGGG + Intronic
931802195 2:65769505-65769527 GGGGCTGGGGGGCTGGGGGAGGG - Intergenic
931814878 2:65890486-65890508 GGGACAGAACGCCTGGGGGAAGG + Intergenic
932259519 2:70315240-70315262 GGGACTAATGCAGTGGGGGAAGG + Intergenic
932338551 2:70944588-70944610 AGGTCTGAAGGGCTGGAGGATGG - Intronic
932416467 2:71576488-71576510 GGGACTGAAGGGTTTGGGGAGGG + Intronic
932666911 2:73705378-73705400 GGGAGTGGAGGGCTGGGGGCCGG + Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
933060084 2:77726115-77726137 GGGAGTAGGGGGCTGGGGGAGGG - Intergenic
933594906 2:84273776-84273798 GGGATAAATGGCCTGGGGGATGG - Intergenic
934315032 2:91909991-91910013 GGGGGTGGAGGGCTGGGGGAGGG + Intergenic
934574259 2:95390561-95390583 AGGGCCAGAGGGCTGGGGGAGGG - Intergenic
934606167 2:95696986-95697008 GGTACTAAAGGGATGAGGGATGG + Intergenic
934656664 2:96119954-96119976 GGGACTGAAAGGCTGGTGGGGGG - Intergenic
934713811 2:96531791-96531813 TGGAGTAAAGGGCTGGGGATCGG - Intergenic
935039889 2:99416109-99416131 GGGACTAAAGAGGTTGGAGATGG + Intronic
935224170 2:101038677-101038699 GGGACAGAAGGGCGGGAGGAAGG + Intronic
935422780 2:102887039-102887061 GGGACTGAGGGGAGGGGGGAGGG - Intergenic
935725698 2:106022047-106022069 GGGAGTATAGGGGTGGGGAAGGG - Intergenic
935809016 2:106777340-106777362 GGGGCTAGAGGAATGGGGGATGG - Intergenic
936116422 2:109706519-109706541 GGGACTGGAGGCCTTGGGGAGGG - Intergenic
936701701 2:115018712-115018734 GGGTGTAAGGGGCTAGGGGAGGG + Intronic
937130660 2:119510126-119510148 GGGGGTAGGGGGCTGGGGGAGGG - Intronic
937165461 2:119811080-119811102 GGGGATTAGGGGCTGGGGGAGGG + Intronic
937724776 2:125149722-125149744 GGGGATAGGGGGCTGGGGGAGGG - Intergenic
938172579 2:129092859-129092881 GGGGGTAGAGGGCTAGGGGAGGG - Intergenic
938266583 2:129932602-129932624 GGGAGTAAAGGGGAGGGGGGTGG + Intergenic
938278152 2:130046013-130046035 GGGGCTAGAGGAGTGGGGGAGGG - Intergenic
938376662 2:130812266-130812288 GGGCCTGGGGGGCTGGGGGACGG - Intergenic
938437226 2:131291372-131291394 GGGGCTAGAGGAGTGGGGGAGGG + Intronic
940054488 2:149499820-149499842 GGGACAGAACAGCTGGGGGAAGG - Intergenic
940084979 2:149849056-149849078 GGGGCTTAAGGGCAGAGGGATGG - Intergenic
940240657 2:151559790-151559812 GGGAGTAGGGGGCTAGGGGAGGG + Intronic
940703330 2:157073602-157073624 GGGAGTGGGGGGCTGGGGGAGGG + Intergenic
940898808 2:159107645-159107667 GGAACAATAGGGCTGGGTGAAGG - Intronic
941748521 2:169111833-169111855 GAGAGTAAAGGGCTGGGAGATGG - Intergenic
942065244 2:172264848-172264870 GGGAGTAGGGGGTTGGGGGAGGG - Intergenic
943037907 2:182768966-182768988 GGGAGTTCAGGGCTGGGGGAGGG - Intronic
943664637 2:190596249-190596271 GGGAGTCAGGGGCTAGGGGAGGG + Intergenic
943767368 2:191677747-191677769 GGGACTAAAGGGCCCGGGCAGGG + Intergenic
943777765 2:191785643-191785665 GGGAGTGAGGGGCTAGGGGAGGG - Intergenic
943837390 2:192530494-192530516 GGGAGTCGAGGGCTAGGGGAGGG + Intergenic
943908314 2:193529594-193529616 GGGGGTAGGGGGCTGGGGGAGGG - Intergenic
944019143 2:195079619-195079641 GGGGCTGGGGGGCTGGGGGAGGG + Intergenic
944267950 2:197748768-197748790 GGGACAAAACACCTGGGGGAAGG + Intronic
944496455 2:200311915-200311937 GGGAATATAAGGATGGGGGAAGG + Intronic
944628802 2:201600436-201600458 GGGGCTGGAGGGCTGGGGAAGGG + Intronic
944633671 2:201653471-201653493 GGGTATAAAAGGCTTGGGGAGGG - Intronic
944830688 2:203531255-203531277 GGGAGTGGGGGGCTGGGGGAGGG + Intronic
944897361 2:204178445-204178467 AGGATTGAAGAGCTGGGGGATGG - Intergenic
945176271 2:207046808-207046830 GGCACCAAAGGGCAGGAGGAGGG + Intergenic
946085725 2:217169309-217169331 GGGGCTGGGGGGCTGGGGGAGGG - Intergenic
946250855 2:218411224-218411246 GGGAGTAAAACACTGGGGGAGGG + Intergenic
946495259 2:220190161-220190183 GGGGCTGCAGGGCTAGGGGAGGG + Intergenic
946609256 2:221440152-221440174 GGGAGGAAAGGGGTGGGGGAAGG + Intronic
947372763 2:229465419-229465441 GGGACCAGGGGGCTGAGGGAGGG + Intronic
947484124 2:230531419-230531441 GGGGTTGAGGGGCTGGGGGAGGG + Intronic
947504400 2:230695987-230696009 AGGGGTAGAGGGCTGGGGGAGGG - Intergenic
947589752 2:231378851-231378873 GGGGCTGAAGGGCTGGGGCCTGG + Intergenic
947634867 2:231674850-231674872 GGGACGTGAGGGCTGGGGGCTGG + Intergenic
948002731 2:234581610-234581632 GGGACTGAGGGGCTGGGGACGGG - Intergenic
948283472 2:236766715-236766737 GGGTTCTAAGGGCTGGGGGAGGG - Intergenic
948284618 2:236773975-236773997 GGGATAAAAGGGGTGGGGAATGG + Intergenic
948498522 2:238372271-238372293 GGGGGCAGAGGGCTGGGGGAGGG - Intronic
1168957084 20:1841776-1841798 GGGACAAAGGGGCTCAGGGAGGG - Intergenic
1169110539 20:3030214-3030236 GAGAGTAAAGGGCAGGGGGCAGG + Intronic
1169247480 20:4034834-4034856 GGGAGCACAGGGTTGGGGGAAGG + Intergenic
1171173427 20:23034859-23034881 AGGATTAAAGGGCAGGGTGAGGG + Intergenic
1172979736 20:38931885-38931907 AGAAATAAAGGGCAGGGGGAAGG + Intronic
1173182226 20:40814107-40814129 CAGGCTGAAGGGCTGGGGGAAGG - Intergenic
1173421574 20:42905917-42905939 GGGGGTAGGGGGCTGGGGGAGGG + Intronic
1173659528 20:44723726-44723748 GGGACTCATGGGCTTGGGAAAGG - Intronic
1173836549 20:46129727-46129749 GGGAAGAAGGGTCTGGGGGAGGG + Exonic
1174037896 20:47679277-47679299 AGAACTAAAGGGGTGAGGGACGG - Intronic
1174115458 20:48223822-48223844 GGGACTGCTGAGCTGGGGGATGG - Intergenic
1174332463 20:49831098-49831120 GAGATTAGAGGGCTGGGGGTGGG - Intronic
1175049125 20:56136976-56136998 GGGGATGGAGGGCTGGGGGAGGG - Intergenic
1175354571 20:58354035-58354057 TGGACTAAATGGCTGCTGGATGG - Intronic
1175416410 20:58804294-58804316 TGGAGTGAAGGGCTGGGGGCAGG - Intergenic
1175725881 20:61318030-61318052 GAGACTAAAGGGCTGGAGGGTGG + Intronic
1175831107 20:61965899-61965921 GGGGCTAGAGGGCTGGGGGCGGG - Intronic
1175943618 20:62548982-62549004 GGGCGTACAGGGCTGGGAGAAGG + Intergenic
1176169073 20:63688999-63689021 GGGAGGAAGGGGCTGGGGGGGGG + Intronic
1177365407 21:20128750-20128772 GGGGCTAGGGGGCTGGAGGAGGG + Intergenic
1177780024 21:25612275-25612297 GGGTGTAGGGGGCTGGGGGAGGG - Intergenic
1177969241 21:27767822-27767844 GGGGGTAGAGGGCTAGGGGAGGG - Intergenic
1178037829 21:28604262-28604284 GGGAGTGAGGGGCTGGGGGAGGG + Intergenic
1178091909 21:29172840-29172862 GGGAACAAGGGGCGGGGGGAGGG - Intronic
1178809083 21:35864907-35864929 GGGGGTAGGGGGCTGGGGGAGGG - Intronic
1178893910 21:36543128-36543150 GGGACTCAACTGCTGGGGCAGGG + Intronic
1179036931 21:37766383-37766405 GGGACAGAAGGGATGGGGGTGGG + Intronic
1179112445 21:38459030-38459052 GGGCATAAAGAGATGGGGGATGG - Intronic
1179124243 21:38577452-38577474 GGGACTTTAGGCCTGGGGGTGGG - Intronic
1179423745 21:41256231-41256253 GGGGGTAGAGGGCTAGGGGAGGG - Intronic
1179628383 21:42661394-42661416 GGGGGTCAGGGGCTGGGGGAGGG - Intronic
1180465315 22:15604938-15604960 GGGACTAAAGGAGAGGGGGATGG - Intergenic
1180678514 22:17605928-17605950 GGGATTATAGGCATGGGGGATGG + Intronic
1181085708 22:20438413-20438435 CGGACCAGAGGCCTGGGGGAAGG + Intronic
1181813839 22:25421635-25421657 GAGAGGACAGGGCTGGGGGAGGG - Intergenic
1181907394 22:26210165-26210187 TGGCCTGAAGGGCAGGGGGAGGG - Intronic
1182684685 22:32112715-32112737 GGTTATCAAGGGCTGGGGGAGGG + Exonic
1183183745 22:36279494-36279516 GGTTGTCAAGGGCTGGGGGAGGG + Intergenic
1183196174 22:36355123-36355145 GGAAGGAAAGCGCTGGGGGATGG - Intronic
1183639716 22:39085440-39085462 GGGGCTGTAGAGCTGGGGGAGGG - Intronic
1183725171 22:39584553-39584575 GAGACCAGAGGGCTGGGGGCTGG + Intronic
1183731781 22:39622413-39622435 GAGTGTAAAGGGCTTGGGGAGGG + Intronic
1183972643 22:41489505-41489527 GGGAAGAAAGTGCTGGGGCAGGG - Intronic
1184046389 22:41975090-41975112 AGGATTAAAGGGCTGGGGGTGGG - Intergenic
1184177335 22:42795806-42795828 GAGACTGAGGGGCGGGGGGAAGG + Intergenic
1184274777 22:43404139-43404161 GGGACAGTAGAGCTGGGGGAGGG - Intergenic
1184274788 22:43404179-43404201 GGGACAGGAGAGCTGGGGGAGGG - Intergenic
1184274807 22:43404236-43404258 GGGACAGGAGAGCTGGGGGAGGG - Intergenic
1184545533 22:45164513-45164535 GGGCTTAAGGGGCTGGAGGACGG + Intronic
1184952353 22:47852805-47852827 AGGATGAAAGGGCTGGTGGAGGG + Intergenic
1185142362 22:49109631-49109653 GGGGCTACAGGGGTGGGGAAGGG - Intergenic
1185205170 22:49533688-49533710 GGCACAAATGGGCTGGGTGAAGG - Intronic
1185345971 22:50310967-50310989 GGGGACACAGGGCTGGGGGAGGG - Exonic
949129923 3:487484-487506 GTGGCTAAAAGGCTGGGGAATGG + Intergenic
949712397 3:6886345-6886367 GGGAGTGAGGGGCTGGGGTAGGG + Intronic
949804558 3:7940209-7940231 GGGGCTGGAGGGCTGGGGGAGGG + Intergenic
950172673 3:10850505-10850527 GGGAGCACAGGGCTGGGAGAGGG + Intronic
950287370 3:11755381-11755403 AGGACTAAAGGGATTGAGGAAGG + Intergenic
951171299 3:19544811-19544833 GGGAGTTGGGGGCTGGGGGAGGG + Intergenic
951609345 3:24473960-24473982 GGGGATGAAGGGCTAGGGGAGGG + Intronic
951917364 3:27816117-27816139 GGGAGTGGAGGGCTAGGGGAGGG - Intergenic
952000285 3:28777370-28777392 GTGACTGGAGGGCTGGTGGAGGG + Intergenic
952724326 3:36567481-36567503 GGGGCTGGGGGGCTGGGGGAGGG - Intergenic
953014580 3:39061240-39061262 GGGGGTAGGGGGCTGGGGGAGGG - Intronic
953080736 3:39615139-39615161 GGGAGTGGGGGGCTGGGGGAGGG - Intergenic
953686061 3:45079285-45079307 GGGTCTGAAGGGCAGGGCGAGGG + Intergenic
954230994 3:49217493-49217515 GGGGCTGGGGGGCTGGGGGAGGG + Intronic
954466098 3:50655721-50655743 GGGACAGAAGGGTTGGGGGGTGG + Intergenic
954628780 3:52037114-52037136 GAGACTGCTGGGCTGGGGGAAGG + Intergenic
955361119 3:58275784-58275806 GGGGGTAGGGGGCTGGGGGAAGG - Intronic
955389880 3:58513988-58514010 GGGAAAAAAGGTCTGGGGGAGGG + Intronic
956077701 3:65523431-65523453 GGGAGGCAAGGGGTGGGGGAGGG + Intronic
956662023 3:71608509-71608531 GGGACTAAAGGGAGGGGAGTTGG - Intergenic
957578577 3:82040618-82040640 GGGAGTAGGGGGCTAGGGGAGGG + Intergenic
957695024 3:83624558-83624580 GGGGGTGAGGGGCTGGGGGAGGG + Intergenic
959041548 3:101427837-101427859 GGGAGTGGGGGGCTGGGGGAGGG - Intronic
959499470 3:107088944-107088966 GGAACCAAAGGTCTGGAGGAGGG + Intergenic
959763459 3:109996604-109996626 GGGGCTGGGGGGCTGGGGGAGGG - Intergenic
960673982 3:120177234-120177256 GGGAGCAGAGGGCTGGGGGATGG + Intronic
961048011 3:123722526-123722548 GGGCCTAGAGGGATGGGGGAGGG + Intronic
961360233 3:126362466-126362488 GGGACTTAAGGGTTTGGGGAAGG - Intergenic
962266692 3:133949024-133949046 GAGACTCAAGGGCTCAGGGAAGG - Intronic
962583742 3:136820205-136820227 GGGTCCAGAGGGCTGGGGGTAGG + Intronic
962584152 3:136824890-136824912 GGGAGTCAGGGGCTGGGGTAGGG - Intronic
962713845 3:138110301-138110323 GGGGATGGAGGGCTGGGGGAGGG + Intronic
962893440 3:139692907-139692929 GGGACTGGAGAGCTGTGGGATGG + Intergenic
963823072 3:149921442-149921464 GGGGGTGGAGGGCTGGGGGAGGG - Intronic
963929284 3:150985245-150985267 GGGGGTAGGGGGCTGGGGGAGGG + Intergenic
964111130 3:153088960-153088982 GGGAGTCGGGGGCTGGGGGAGGG - Intergenic
964264702 3:154880986-154881008 GGGAGTGGGGGGCTGGGGGAGGG + Intergenic
964393318 3:156219858-156219880 GGGGGTTAGGGGCTGGGGGAGGG - Intronic
964411450 3:156402000-156402022 GGGACTGGGGAGCTGGGGGAGGG + Intronic
964560953 3:157995430-157995452 GGGGGTAGGGGGCTGGGGGAGGG + Intergenic
964817588 3:160732968-160732990 GGGACTACTGGGTTGGGGGGCGG + Intergenic
967176601 3:186866338-186866360 GGGAGCACAGGGTTGGGGGAAGG + Intergenic
967303107 3:188036254-188036276 GGAACTAAAGGGTTGGGAGTTGG + Intergenic
967719078 3:192796189-192796211 GGGGGTAGGGGGCTGGGGGAGGG + Intergenic
968156878 3:196388301-196388323 GGGGCTGGGGGGCTGGGGGAGGG + Intronic
968534062 4:1112922-1112944 GGGAGTGAGGGGCTGCGGGAGGG - Intronic
969605782 4:8201615-8201637 GGGCCTGCAGGGCTGAGGGAGGG + Intronic
969706763 4:8796863-8796885 GGGACTTAATGCCTGGGGGCTGG - Intergenic
970651123 4:18179095-18179117 GGGGCTGGGGGGCTGGGGGAGGG + Intergenic
970816550 4:20162643-20162665 AGGAATAAAGGGGTGGGGGGGGG + Intergenic
971863780 4:32142653-32142675 GGGAGTGTTGGGCTGGGGGAGGG - Intergenic
972885923 4:43487786-43487808 GGGGGTACGGGGCTGGGGGAAGG - Intergenic
973884099 4:55303126-55303148 GGGCGTGAGGGGCTGGGGGAGGG + Intergenic
974254061 4:59426828-59426850 GAGACTGAGGGGCTGTGGGAAGG - Intergenic
974366718 4:60959565-60959587 GGTACTAAAGGGCAAGGAGAAGG + Intergenic
974847283 4:67366376-67366398 GGGATGGAAGGGCTGGTGGAAGG - Intergenic
975525259 4:75341836-75341858 GGGGGTGGAGGGCTGGGGGAGGG - Intergenic
975843488 4:78501107-78501129 GAGGATGAAGGGCTGGGGGAGGG - Intronic
976688717 4:87845232-87845254 GGGAATAAAGGGTTTGAGGATGG + Exonic
976841120 4:89433338-89433360 GTGGCTAAAGGTCTGGGGGAAGG + Intergenic
977195068 4:94047946-94047968 GGGGGTGGAGGGCTGGGGGAGGG + Intergenic
977947265 4:102928076-102928098 GGGGGTGGAGGGCTGGGGGAGGG + Intronic
978259744 4:106741164-106741186 GGGACTGCAGGGCTAGGGGAGGG - Intergenic
978340540 4:107717911-107717933 GGGGCTGAAGGGCTGGGGTAAGG - Intronic
978695723 4:111575774-111575796 GGGGATTAGGGGCTGGGGGAGGG - Intergenic
979096681 4:116559594-116559616 GGGGCTGGTGGGCTGGGGGAGGG + Intergenic
979320347 4:119315969-119315991 GAGACTAAAGGGGTGGAGTAGGG + Intergenic
980476936 4:133330496-133330518 GGGGGTAGGGGGCTGGGGGAGGG - Intergenic
980791194 4:137621344-137621366 GAGACTAAAGGGAAGGGTGATGG + Intergenic
981036594 4:140176110-140176132 GGGAGGAAAGGGCTGAGGAAAGG - Intergenic
981247270 4:142554992-142555014 GGTCCTAAGGGCCTGGGGGATGG + Intronic
982120992 4:152143523-152143545 GGGGGTGAGGGGCTGGGGGAGGG + Intergenic
982179301 4:152734791-152734813 GGGAATAAAGGACTGGGAGGTGG + Intronic
983124807 4:163937909-163937931 GGGAATCAAGGGGTGGAGGATGG - Intronic
983234818 4:165167249-165167271 GGGGGTGGAGGGCTGGGGGAGGG + Intronic
983552346 4:169030864-169030886 GGGAGCCAAGGGATGGGGGAAGG - Intergenic
983649929 4:170027289-170027311 GGCACTAAAAAGCCGGGGGAAGG - Intronic
983962539 4:173772125-173772147 GGGACTAAGGGGCATGGGGTTGG - Intergenic
984834597 4:184008028-184008050 GAGACTAAAAGGCTGGGGCCGGG - Intronic
984985828 4:185328867-185328889 GGGACTGAAGGCTTGGGGGCAGG + Intronic
985189610 4:187358053-187358075 AGCTCTAATGGGCTGGGGGAGGG - Intergenic
985988169 5:3534731-3534753 GGGCCTGTGGGGCTGGGGGAGGG + Intergenic
988820270 5:34876838-34876860 GGGGCTGGGGGGCTGGGGGAGGG + Intronic
988965377 5:36411512-36411534 GGGGCTGGAGAGCTGGGGGAGGG - Intergenic
989312656 5:40038423-40038445 GTGACTAAAGTTCTGGGGAATGG + Intergenic
989344749 5:40417373-40417395 GGGGATGAGGGGCTGGGGGAGGG - Intergenic
990869802 5:60418850-60418872 GGGGCTAAGGGGGAGGGGGATGG - Intronic
991523136 5:67523651-67523673 GGGGCTGGAGGGCTAGGGGAGGG - Intergenic
992054685 5:72976763-72976785 GGGGCTGGGGGGCTGGGGGAGGG - Intronic
993520025 5:88889386-88889408 GGGAGAAAAGGGGGGGGGGAAGG - Intronic
993883164 5:93386477-93386499 GGCAATAAAGGGCAGGGGGCAGG + Intergenic
994599709 5:101887389-101887411 GGGGGTGAGGGGCTGGGGGAGGG - Intergenic
994723147 5:103403592-103403614 GGGCATAAAAGGCTGGGTGATGG + Intergenic
994834510 5:104831903-104831925 GGGGTTAGGGGGCTGGGGGAGGG + Intergenic
995108576 5:108402625-108402647 GGGGCTGGGGGGCTGGGGGAGGG - Intergenic
995521785 5:113014258-113014280 GAGACTAAAGGGTTGGAGGCAGG - Exonic
996041074 5:118811861-118811883 GGGAGTCAGGGGCTAGGGGAGGG + Intergenic
996532527 5:124541475-124541497 GAGACAAAGGGGCTGAGGGAGGG + Intergenic
996581045 5:125032750-125032772 GGCAGTATAGGGCTGGGGAATGG + Intergenic
996622288 5:125521829-125521851 GGGACTAAGGGCCAGAGGGAAGG - Intergenic
996769982 5:127075463-127075485 GGGCCTACAGTGCTGGGGAAGGG + Intergenic
996841730 5:127853844-127853866 AGGACTATGGGGCTGAGGGAAGG - Intergenic
997070234 5:130612979-130613001 GGGATTGAGGGGTTGGGGGAGGG + Intergenic
997146483 5:131439851-131439873 GGGACTAAATGACTGGGTAATGG + Intronic
998352204 5:141508958-141508980 GGAATGAAAGGGCTGGGGGTGGG + Intronic
998454369 5:142259954-142259976 GTGACTGAAGGGCTGGGGACAGG - Intergenic
998978371 5:147673162-147673184 GAGAGAAAAGGGGTGGGGGAAGG + Intronic
999480585 5:151944670-151944692 GGGAGTGAGGGGCTGGGGGAGGG - Intergenic
999735928 5:154512970-154512992 GGAAATGAAGGGCTGGGGGCGGG - Intergenic
1000670535 5:164057243-164057265 GGGCCTAAAGGGAAGGGGAAGGG + Intergenic
1001368795 5:171174941-171174963 GGGGGTGAAGGGCTAGGGGAGGG - Intronic
1001427432 5:171632728-171632750 GATCCTAAAGGGCTGTGGGAGGG - Intergenic
1002168870 5:177364235-177364257 GGGAATAAGGGGCTGGTGGTAGG + Intronic
1002190086 5:177473399-177473421 GGGACAAAGGGGCCGGGGGCGGG + Intronic
1003169413 6:3709402-3709424 GGGATGCCAGGGCTGGGGGATGG - Intergenic
1003393127 6:5730346-5730368 GGTACTAAATAGTTGGGGGAAGG + Intronic
1004289767 6:14355881-14355903 GGGGCTGGGGGGCTGGGGGAGGG - Intergenic
1004339775 6:14798186-14798208 GGGAGGGAAGGGTTGGGGGAGGG + Intergenic
1004826640 6:19429099-19429121 GGGGGTAGAGGGCTAGGGGAGGG - Intergenic
1004959529 6:20771031-20771053 GGGACTTAAGGTCTCGAGGAAGG - Intronic
1005982098 6:30844365-30844387 GGGGCAAAAGGGTTGGGGAAGGG + Intergenic
1006470778 6:34227455-34227477 GAGTGAAAAGGGCTGGGGGAGGG - Intergenic
1006700463 6:35968781-35968803 GGGGGTAAGGGGCTGGGGGCGGG - Intronic
1006809570 6:36811155-36811177 GGGGCTAGAAGGCTGGGGGTGGG - Intronic
1006903355 6:37516897-37516919 GAGAGTGATGGGCTGGGGGATGG + Intergenic
1007073557 6:39053110-39053132 GGGTCTAAAGGGCCATGGGAAGG - Intronic
1007104502 6:39274203-39274225 GGGACTACAGGGCTGGGACTAGG + Intergenic
1007209383 6:40179943-40179965 GAGTCCAAAGGGCTGGGGGTGGG + Intergenic
1007407893 6:41645271-41645293 GGGGGAAAAGGGATGGGGGATGG - Intronic
1007417500 6:41700630-41700652 GAGACTGCAGGGCTGGGGGCAGG + Intronic
1007627374 6:43254039-43254061 GGGACTGAGGGGCTGGGGCTTGG + Intronic
1007769337 6:44180507-44180529 GAGACTGTAGGGCTGGGGGTTGG + Intronic
1008055996 6:46946623-46946645 GGGAATAAAGGGCAGGAGCACGG + Intronic
1008058095 6:46966311-46966333 GGGTGTGAAGGGCTGGGGGATGG - Intergenic
1008225555 6:48910593-48910615 GGGGGTAAAGGTCTAGGGGAGGG + Intergenic
1008572980 6:52832744-52832766 GGCACTGAAGGGCTGGAGAAGGG + Intronic
1008995554 6:57654106-57654128 GGGAGTGGGGGGCTGGGGGAGGG + Intergenic
1009688703 6:66997935-66997957 GGGGGTGGAGGGCTGGGGGAGGG + Intergenic
1009731461 6:67613426-67613448 GGGGCTAGGGGGCTAGGGGAGGG - Intergenic
1009805286 6:68594776-68594798 GGGGGTGGAGGGCTGGGGGAGGG - Intergenic
1009944791 6:70330777-70330799 GGGAGTGAGGGGCTAGGGGAGGG - Intergenic
1010013305 6:71074858-71074880 GGGAGGGAAGGGTTGGGGGAAGG + Intergenic
1010181476 6:73091322-73091344 GGGGTTAGGGGGCTGGGGGAGGG + Intronic
1010789441 6:80048226-80048248 GGGATTGGGGGGCTGGGGGAGGG - Intergenic
1011886072 6:92097067-92097089 GGGAGTAGGGGGCTAGGGGATGG + Intergenic
1011903642 6:92333680-92333702 GGTTATCAAGGGCTGGGGGAGGG - Intergenic
1012222360 6:96664398-96664420 GGTTCTCAGGGGCTGGGGGAAGG - Intergenic
1012349580 6:98233878-98233900 GGGTGTAGAGGGCTGGGGAAGGG - Intergenic
1012577336 6:100819165-100819187 GGGGCTGGGGGGCTGGGGGAGGG + Intronic
1012974242 6:105762916-105762938 GGGAGTAGGGGGCTAGGGGAGGG + Intergenic
1013019931 6:106204077-106204099 GGGAGTAGGGGGCTAGGGGAGGG + Intronic
1013304682 6:108837469-108837491 GGGAGGAGAGGACTGGGGGAGGG + Intergenic
1013455194 6:110323741-110323763 GGTAGGGAAGGGCTGGGGGAAGG + Intronic
1013942342 6:115679866-115679888 GTGAGTAAAGGGCTGTGTGAAGG - Intergenic
1014159955 6:118156524-118156546 GGGGTTGAGGGGCTGGGGGAGGG + Intronic
1014396924 6:120935344-120935366 GGGATTGAGGGGATGGGGGAAGG - Intergenic
1015589124 6:134805463-134805485 GCGTGTAAAGGGCTGGAGGAGGG - Intergenic
1015708559 6:136114697-136114719 GGGAACACAGGGCTGGGGGTGGG - Intronic
1016005456 6:139084564-139084586 GGGGCTAGGGGGCTGGGGGAGGG - Intergenic
1016622445 6:146127923-146127945 GTGGCTCAAAGGCTGGGGGATGG + Intronic
1017700489 6:157064806-157064828 GGGGCTGAAGGGCAGGGGGCAGG - Intronic
1017840960 6:158222604-158222626 GGGAAGAAAAGGGTGGGGGAGGG + Intergenic
1018789297 6:167134408-167134430 GGGCCTAAAAAGCTGGAGGAAGG - Intronic
1018957418 6:168419566-168419588 AAGACTATAGGGCTGGGGAAGGG + Intergenic
1019531814 7:1507027-1507049 GGGTTGAAAGGGATGGGGGATGG - Intergenic
1019932106 7:4230457-4230479 GGGAGTGGAGGGCAGGGGGAAGG + Intronic
1020169167 7:5831755-5831777 GGGAGTGAAGGTCTGGAGGAGGG - Intergenic
1020497607 7:8876102-8876124 GGAACAAAAAGGCTGAGGGAGGG - Intergenic
1020553652 7:9641143-9641165 GGGGGTGAGGGGCTGGGGGAGGG - Intergenic
1021099783 7:16574648-16574670 GGGGCTGGAGGGCTGGGGGAGGG + Intronic
1021869995 7:24996408-24996430 GGGGGTGAGGGGCTGGGGGAGGG - Intergenic
1022190385 7:28011882-28011904 GGGACTTAAGGGATGGGAGATGG + Intronic
1022221967 7:28322587-28322609 GGGAGTGGGGGGCTGGGGGAGGG - Intronic
1022901971 7:34819921-34819943 GGGAGTGAGGGGCTGGGGGAGGG + Intronic
1022958556 7:35403392-35403414 GGGGGTAAGGGGCTAGGGGAGGG + Intergenic
1023014891 7:35956971-35956993 GGGGGTGGAGGGCTGGGGGAAGG - Intergenic
1024030298 7:45455040-45455062 GGGAGTAGGGGGATGGGGGAGGG - Intergenic
1024601953 7:50990201-50990223 GGGGCTGGGGGGCTGGGGGAGGG - Intergenic
1025853698 7:65260993-65261015 GGGAGCACAGGGTTGGGGGAAGG + Intergenic
1026292709 7:69022717-69022739 GGGAGTAAGGGGCAAGGGGAGGG - Intergenic
1026869618 7:73842328-73842350 GGGGCTGCAGGGCTGGGGGAAGG + Intronic
1028009340 7:85620651-85620673 GGGGGTGGAGGGCTGGGGGAGGG + Intergenic
1028736744 7:94221825-94221847 GGGGGTAGGGGGCTGGGGGAAGG + Intergenic
1029058458 7:97771642-97771664 GGGACTGAAAGGCGGGAGGAAGG + Intergenic
1029286370 7:99468679-99468701 TGGACTTGAGGGCTGGGGCAGGG + Intergenic
1029502432 7:100940749-100940771 GGGGCTGGCGGGCTGGGGGAGGG - Intergenic
1029536622 7:101161109-101161131 GGGAAGGAAGGGTTGGGGGAAGG + Exonic
1029588770 7:101493222-101493244 GGGAGGCAAGGGCAGGGGGAAGG - Intronic
1030091972 7:105865850-105865872 GGTATTCAGGGGCTGGGGGAGGG - Intronic
1030573536 7:111257922-111257944 GGGGCTGGGGGGCTGGGGGAGGG - Intronic
1031009694 7:116513005-116513027 CGGCATACAGGGCTGGGGGAGGG - Intergenic
1031302840 7:120085120-120085142 GGGGCTAAGGGGCTAGGGGAGGG + Intergenic
1031403941 7:121360591-121360613 GGGAGGTCAGGGCTGGGGGATGG + Intronic
1031566109 7:123298882-123298904 GGGGGTGAGGGGCTGGGGGAAGG - Intergenic
1032341836 7:131080926-131080948 GAGACAAAAGGGCCAGGGGATGG - Intergenic
1033046652 7:137968351-137968373 GGGAGTCTGGGGCTGGGGGATGG - Intronic
1033327280 7:140390261-140390283 TGGTCAAAAGGGCTGGGGGTGGG - Intronic
1033954172 7:146824027-146824049 GGGGTTGGAGGGCTGGGGGAGGG - Intronic
1034425597 7:151012482-151012504 GGGACTAAAGGACTGCCTGAAGG + Exonic
1035311784 7:157974375-157974397 GGGAATCAAGGGCAGGTGGAAGG - Intronic
1035529932 8:343166-343188 GAGAGTAATGGGCTGGGTGACGG - Intergenic
1037249554 8:16876940-16876962 GGGACTGAACCTCTGGGGGAAGG - Intergenic
1037467251 8:19172621-19172643 GGGAGGAAAGGGGAGGGGGAGGG + Intergenic
1037908949 8:22732160-22732182 GGGACTGGAGGGCCCGGGGAAGG + Intronic
1038213025 8:25537442-25537464 GGGTCTGCAGGGCTGGGCGATGG + Intergenic
1038390598 8:27196812-27196834 GTGGTTAGAGGGCTGGGGGAGGG - Intergenic
1039648120 8:39309117-39309139 GGGGCTGGGGGGCTGGGGGAAGG + Intergenic
1039724176 8:40197457-40197479 AGGACAAAAGGGTGGGGGGAGGG + Intergenic
1039865997 8:41502536-41502558 GGGACAAATGGGCTCGTGGAAGG + Intronic
1041580277 8:59450570-59450592 GGGGGTCAGGGGCTGGGGGAGGG + Intergenic
1041624087 8:60005161-60005183 GGGGCTAGGGGGCTGGAGGAGGG + Intergenic
1041681236 8:60594623-60594645 GGGGTTGAAGGGCTGGGGGAGGG - Intronic
1041817498 8:61991628-61991650 GGGAGTGGAGGGCTAGGGGAAGG - Intergenic
1041987102 8:63935262-63935284 GGGGCTAGGGGGCTAGGGGAGGG - Intergenic
1042312931 8:67396599-67396621 GGGACTAGGGGGATGGGGGTGGG - Intergenic
1043147790 8:76678335-76678357 GGGGTTAATGGGCTGAGGGAAGG - Intergenic
1043165318 8:76896239-76896261 GGGTGTGAGGGGCTGGGGGAGGG - Intergenic
1043195781 8:77289754-77289776 GGGACTAGCGGGGTTGGGGAAGG - Intergenic
1043598099 8:81907184-81907206 GGGGGTAGGGGGCTGGGGGAGGG + Intergenic
1043633227 8:82363433-82363455 GGGAGTGGGGGGCTGGGGGAGGG - Intergenic
1044430893 8:92104496-92104518 GGGTTTAAAAGGATGGGGGAAGG - Intergenic
1044732722 8:95243635-95243657 GGGGCTAGGGGGCTAGGGGAGGG + Intergenic
1044763485 8:95547518-95547540 GGGGGTGAGGGGCTGGGGGAGGG + Intergenic
1045313754 8:101026184-101026206 GGGACTCAGAGGCTGGGGGAGGG - Intergenic
1048021029 8:130539305-130539327 GGGGGTTAGGGGCTGGGGGAGGG - Intergenic
1048360637 8:133694311-133694333 GGGACAGAGGGCCTGGGGGAGGG + Intergenic
1049171362 8:141163082-141163104 GGAACTAGTGGGCTGGAGGAAGG + Intronic
1049185023 8:141245721-141245743 AGGAGTCAAGGGCAGGGGGAAGG + Intronic
1049231076 8:141481885-141481907 GACAGTAAAGGTCTGGGGGAGGG - Intergenic
1049270616 8:141693712-141693734 GGGTTTGAAGGGCTGGGGGCAGG + Intergenic
1049283580 8:141762747-141762769 GGGACTAAATGGTGAGGGGAGGG + Intergenic
1049471194 8:142775748-142775770 GGGCCTGATGGGCTGGAGGAGGG - Intronic
1049613851 8:143567892-143567914 GGGACAAAAGGGCTAGTGGCAGG + Intronic
1049988917 9:974930-974952 AGGATTAAAGTGGTGGGGGAAGG + Intergenic
1050141506 9:2521111-2521133 GGGACAGAAGACCTGGGGGAAGG - Intergenic
1051619435 9:19036105-19036127 GGGGGTAGGGGGCTGGGGGAGGG + Intronic
1052020558 9:23520684-23520706 GGGAGTAGGGGGCTGGGGGAGGG + Intergenic
1052805435 9:33009318-33009340 GGGACTAAAGAGGTGGTGGAAGG - Intronic
1053167165 9:35853109-35853131 GAGACTCAAGGGCTGGGCTAGGG - Intronic
1055580842 9:77705042-77705064 GGGGCTAGGGGGCTAGGGGAGGG - Intergenic
1055784920 9:79862319-79862341 GGGGCTGCGGGGCTGGGGGAGGG - Intergenic
1056435150 9:86568724-86568746 GGGTCTCAACAGCTGGGGGATGG + Intergenic
1056544932 9:87605799-87605821 GGGACTGGAGGGGTGGGAGAGGG - Intronic
1056945595 9:90993330-90993352 GGGAATGGGGGGCTGGGGGAAGG - Intergenic
1057160409 9:92884738-92884760 GAGAGTAAAGGCCTGGGGCAAGG + Intergenic
1058528357 9:105882548-105882570 GGGAATGGGGGGCTGGGGGAGGG - Intergenic
1058785221 9:108380475-108380497 AGGTCTAATGGGCTGGAGGAAGG - Intergenic
1059434368 9:114267320-114267342 GGAACTAGGGGGCTGGGGGTGGG - Intronic
1060189310 9:121582083-121582105 GGGGCTGCAGGGCTGGGGAAGGG + Intronic
1060267398 9:122120370-122120392 GGCAGGGAAGGGCTGGGGGAGGG - Intergenic
1060921692 9:127424779-127424801 GGGACTCAAATGCTGGAGGAAGG + Exonic
1061227473 9:129289098-129289120 GTGACCACAGGGCTGGGGTAAGG - Intergenic
1061255785 9:129453713-129453735 GGGAATGGAGGGATGGGGGATGG + Intergenic
1061255798 9:129453751-129453773 GGGAATGGAGGGATGGGGGATGG + Intergenic
1061708776 9:132473094-132473116 GGGAGTCAGGGGTTGGGGGAGGG + Intronic
1185581350 X:1213202-1213224 GGGAGGAAAGGGAAGGGGGAGGG - Intergenic
1185587146 X:1248665-1248687 GGGATTCCAGGGGTGGGGGAGGG - Intergenic
1185716468 X:2346790-2346812 GGGAGTAGGGGACTGGGGGAGGG - Intronic
1186067578 X:5782836-5782858 GGGGATAGGGGGCTGGGGGAGGG - Intergenic
1187237249 X:17479045-17479067 GGGAGTGAGGGGCTAGGGGAGGG - Intronic
1187297792 X:18018998-18019020 GGGGGTAGAGGGCTGGGGGAGGG + Intergenic
1187574477 X:20540155-20540177 GGGGCTGGGGGGCTGGGGGAGGG - Intergenic
1187788881 X:22925702-22925724 GGGAGTAAAAGTCAGGGGGATGG - Intergenic
1188313046 X:28641205-28641227 GGGAGTGGTGGGCTGGGGGAGGG - Intronic
1189230897 X:39451528-39451550 GTGACTTAAGGGATAGGGGAGGG - Intergenic
1189462059 X:41250853-41250875 GGGAGTAAAAGGGTGAGGGAAGG + Intergenic
1189613709 X:42763902-42763924 GGGGCTAAAGGCTTGGGGGCAGG - Intergenic
1189875291 X:45430402-45430424 GGGGCTGGGGGGCTGGGGGAGGG - Intergenic
1190220537 X:48509648-48509670 GGTACTGGAGGACTGGGGGAAGG - Intronic
1190225306 X:48540185-48540207 GGGGCTATGGGGCTGGAGGAGGG + Intronic
1190259665 X:48789991-48790013 GGGAAGAAAGGACGGGGGGACGG + Intronic
1190326939 X:49212305-49212327 AGGCCTATAGGGATGGGGGAGGG + Exonic
1190332085 X:49242308-49242330 GGGGCTACAGGGCAGGGGGCAGG + Intronic
1190458931 X:50651723-50651745 GGGGTTAAGGGGCTAGGGGAGGG - Intronic
1190909298 X:54757275-54757297 GGGAGTAAAGGGCATGGGGAGGG + Exonic
1191096601 X:56679689-56679711 GGGGCTGAGGGGCTAGGGGAGGG + Intergenic
1191821312 X:65311994-65312016 GGGAGTAGGGGGCAGGGGGAGGG + Intergenic
1191991833 X:67046309-67046331 AGGATTTAAGGGCTGGGGTATGG + Intergenic
1192074094 X:67972971-67972993 GGGCGTACAGGGCTAGGGGAGGG + Intergenic
1192203316 X:69080975-69080997 GGAGGTGAAGGGCTGGGGGAGGG - Intergenic
1192359531 X:70430377-70430399 GGGAGTGATGGGCTGGGGCAGGG + Intronic
1192418157 X:71003143-71003165 GGGGTTAAGGGGCAGGGGGATGG + Intergenic
1192435497 X:71141153-71141175 AGAACTAAAGGGCTGAGGGCAGG - Intronic
1192491555 X:71580079-71580101 GGGAGTAAAGAGGTAGGGGAAGG + Intronic
1192525270 X:71837422-71837444 GGGGCTGGGGGGCTGGGGGAGGG + Intergenic
1192557409 X:72101557-72101579 GGGGAGAAAAGGCTGGGGGAGGG - Intergenic
1192906078 X:75551975-75551997 GGGAGTAGGGGGCTAGGGGAGGG + Intergenic
1192998976 X:76542727-76542749 GGGAGTGAGGGGCTAGGGGAGGG - Intergenic
1193103602 X:77643299-77643321 GTGACTACAGGCCTGGGGCAAGG + Intronic
1193166677 X:78289104-78289126 GGGGGTGGAGGGCTGGGGGAGGG - Intronic
1193650865 X:84129859-84129881 GGGACTTAGGGGATGAGGGATGG + Intronic
1193768790 X:85563838-85563860 GGGGATGAGGGGCTGGGGGAGGG - Intergenic
1193794928 X:85862623-85862645 GGGACTAAAGAGATGGGGAGGGG + Exonic
1194537125 X:95119289-95119311 GGGACAAAGTGTCTGGGGGAAGG - Intergenic
1195249852 X:103032323-103032345 AGGACTAGAGGGCTGGGGGGAGG + Intergenic
1195301071 X:103530460-103530482 GGGACAAATGGGGTGGGGAAAGG - Intergenic
1195764768 X:108284310-108284332 GGGGCTGGGGGGCTGGGGGAGGG + Intronic
1195827591 X:109019469-109019491 GGGGCTAGGGGGCTGGGGGAGGG - Intergenic
1196037982 X:111167724-111167746 GGGAGTAGGGGGCTAGGGGAGGG + Intronic
1196650588 X:118164593-118164615 GGGGGTAAGGGGCTAGGGGAGGG + Intergenic
1196979206 X:121193172-121193194 GGGGGTAGGGGGCTGGGGGAGGG - Intergenic
1197064351 X:122220838-122220860 TGGACTCCAAGGCTGGGGGAGGG - Intergenic
1197298079 X:124743989-124744011 GGAAGAAATGGGCTGGGGGAGGG - Intronic
1198042896 X:132871780-132871802 GGGAGTGAGGGGCTAGGGGAGGG + Intronic
1198517826 X:137427060-137427082 GGGAGGAAGGGGATGGGGGAGGG + Intergenic
1198772749 X:140148325-140148347 GGACTTAAAGGGCTGGGAGAAGG + Intergenic
1199344625 X:146723960-146723982 GGGGCTGGAGGGCTGGGGGCAGG + Intergenic
1199645530 X:149906585-149906607 GGGGGTAGGGGGCTGGGGGAGGG + Intergenic
1200422485 Y:2986380-2986402 GGGAGTAAAGGAGTGGGGCAAGG - Intergenic
1201145632 Y:11063837-11063859 TGGATTAAAGGGTGGGGGGAGGG + Intergenic
1201498276 Y:14613579-14613601 GGCACTGAGGGGCTTGGGGAGGG - Intronic