ID: 1108206453

View in Genome Browser
Species Human (GRCh38)
Location 13:48095014-48095036
Sequence GGAGGCGGTTTGGGAGTGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 373
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 339}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108206453 Original CRISPR GGAGGCGGTTTGGGAGTGGC GGG (reversed) Exonic
900092164 1:925255-925277 GGAGGCGGGTTGGGAGGGCGCGG + Intronic
900323263 1:2095318-2095340 GGAGGTGGCTGGGCAGTGGCGGG + Intronic
900720411 1:4172281-4172303 GGAGGAGGTGTGGGAGCTGCAGG - Intergenic
900827616 1:4939241-4939263 GGCTGCAGTTTGGCAGTGGCTGG - Intergenic
901843245 1:11966492-11966514 GGCGGCGGGATGGGAGTGGGGGG + Intronic
902388163 1:16087987-16088009 GGAGAAGGTTTGGGAGCTGCGGG - Intergenic
902782186 1:18711941-18711963 GGATGTGGTTTGGGTGGGGCAGG - Intronic
903065535 1:20697202-20697224 GGAGGTGGTAGGTGAGTGGCAGG + Intronic
903532382 1:24041485-24041507 GGAGGGGGTTAGTGAGTGTCTGG + Intergenic
903772866 1:25775065-25775087 GGAGGCGGTCTGGAAGGTGCAGG + Intronic
903777222 1:25800566-25800588 GGAGGCGGGTGGGGGGTGCCTGG + Intronic
903810448 1:26032330-26032352 GAAGGCGGGTTGCGAGGGGCAGG - Intronic
904680042 1:32222644-32222666 GGAGGGGGTCCGGGAGGGGCGGG + Intronic
904714185 1:32454612-32454634 GGAGGCTGCTTGGCAGTGACAGG + Intergenic
905299562 1:36977253-36977275 GGACCTGGTTTGGGAGAGGCAGG - Intronic
905325613 1:37149703-37149725 GAAGGCGTTTTGGGAGAAGCTGG - Intergenic
905886162 1:41493295-41493317 GGAGGAGGTTTGGGTGAGGCAGG + Intergenic
905966508 1:42102938-42102960 GGTGAGGGTTTGGGACTGGCTGG + Intergenic
906314390 1:44776780-44776802 TGAGGCCCTTTGGGAGTGGGTGG + Intronic
907509159 1:54945676-54945698 GGAGGAGCCTTGGGTGTGGCAGG + Intergenic
908523911 1:64969408-64969430 GGAGGAGGGTGGGGAGTTGCGGG - Intergenic
908683441 1:66688097-66688119 GGAGGTGGTAAGGGGGTGGCAGG + Intronic
910796599 1:91103512-91103534 AAAGGCGGTTTCAGAGTGGCTGG + Intergenic
912541661 1:110420768-110420790 GGTGGGGGCTTGGGAGGGGCTGG + Intergenic
913110617 1:115654171-115654193 GGAGGCGGGTTGGGGTTGGAGGG + Intronic
914302280 1:146387345-146387367 GGGGGTGGTTGGGGATTGGCTGG + Intergenic
915339308 1:155167554-155167576 GGAGGGGGGAAGGGAGTGGCGGG - Intergenic
915625523 1:157111880-157111902 GGAGGCGGTGTGTGAGTGTGCGG + Intergenic
915683978 1:157612113-157612135 GGAGATGGTTTGGAAGTGGGTGG + Intergenic
915946240 1:160153928-160153950 GGCAGAGGTTGGGGAGTGGCTGG + Intronic
916170106 1:161995578-161995600 GGAGGCAGTTGGGGAGAGGCTGG + Intronic
916786576 1:168091165-168091187 CGGGGAGGTTTGGGAGAGGCAGG + Intronic
918597159 1:186307145-186307167 GCAGGCTCTTTGGGAGTGGTGGG - Exonic
918597268 1:186307523-186307545 GCAGGCTCTTTGGGAGTGGTGGG - Exonic
918984962 1:191613599-191613621 GGAGTGGGTTGGGGAGTGCCAGG + Intergenic
919486840 1:198157022-198157044 GGAGGAGGATCGGGAGTCGCGGG + Exonic
919527325 1:198669671-198669693 AGAAGGGGTCTGGGAGTGGCTGG - Intronic
920024443 1:202982974-202982996 GGAGAGGGATGGGGAGTGGCTGG + Intergenic
922415046 1:225413842-225413864 GGAGCCAGTGGGGGAGTGGCTGG - Intronic
922757659 1:228105498-228105520 GGTGGCGGTCAGGGAGTGGAGGG + Intergenic
923144384 1:231187680-231187702 GGAGGCGGAGTGGGAGAGGCGGG + Intronic
924051104 1:240080399-240080421 GGAGGGGGTTGGGGAATGGGTGG - Intronic
924172331 1:241356217-241356239 GGATGCGGTGGGGGAGTGGGGGG + Intronic
924651627 1:245933930-245933952 GGAGGGGGCTGGGAAGTGGCTGG - Intronic
924784237 1:247180653-247180675 GGAGGCTCTTGGGGAGCGGCTGG - Intergenic
924835054 1:247639432-247639454 GGAGGCGGAGTGGGAGGAGCGGG + Intergenic
1063381880 10:5590779-5590801 GGAGGCAGTTAGGGAGGGCCTGG - Intergenic
1063803779 10:9613734-9613756 GCAGGCGATTTGGGAGATGCTGG + Intergenic
1064245002 10:13661301-13661323 GGAGGTGCTGTGGGAGAGGCTGG + Intronic
1064767261 10:18687348-18687370 GGAGGCTGTGTGGGGGTGGGAGG - Intergenic
1064902585 10:20311320-20311342 GGATGAGATTTGGGAGAGGCTGG - Intergenic
1065906895 10:30262983-30263005 GGACATGATTTGGGAGTGGCTGG + Intergenic
1067296654 10:44978625-44978647 TGAGGAGGTCTGGGGGTGGCAGG + Exonic
1068395468 10:56456448-56456470 GGATGCGGTATGGTAGGGGCTGG - Intergenic
1069994143 10:72332350-72332372 GGGGGCGGTTTGGGGGAGGATGG + Intergenic
1070433074 10:76360751-76360773 GGAGGGGGTTTTGGAGTTTCAGG - Intronic
1070795325 10:79213042-79213064 GGTGGCGGGGTGGGGGTGGCAGG - Intronic
1070949003 10:80415822-80415844 GGAGGCTGTTTGAGTGTGGCAGG + Intronic
1070988873 10:80714037-80714059 GGAGGTGGTTTTGGAATGACAGG + Intergenic
1072107668 10:92290348-92290370 GCAGGTGGATTGGGAGTGGCGGG - Intronic
1073267244 10:102235173-102235195 GGAGGCGGTGGGGGGGTGGGGGG - Intronic
1073815691 10:107204192-107204214 GGAGGAGGGTAGGGGGTGGCGGG + Intergenic
1075610681 10:123852398-123852420 GGAGGGGGGTTGGAAGTGGTTGG - Intronic
1075779267 10:125006304-125006326 GGTGGGGGGTTGGGAGTGGGTGG + Intronic
1076212413 10:128659122-128659144 GGAGGGGGTCTGGCAGTGCCTGG - Intergenic
1077482307 11:2821499-2821521 GGAGGCCATTGGGAAGTGGCTGG + Intronic
1078780624 11:14435676-14435698 GGAGGCGGTTGGGGAAAGGAGGG + Intergenic
1080213804 11:29817946-29817968 GGGGGCGGTTGGAGGGTGGCTGG + Intergenic
1082807967 11:57461968-57461990 GCAGGCGCTTTGGGAATGGAGGG - Intronic
1083766878 11:64845452-64845474 GGAGGAGGTTGGGGAGGGGAGGG + Intergenic
1083888840 11:65585701-65585723 GGTGACGGTTTCAGAGTGGCGGG + Intronic
1083961564 11:66017512-66017534 GGAGGTGAGTTGTGAGTGGCTGG - Intronic
1084573594 11:69975007-69975029 GGAGGCAGCCTGGGAGGGGCTGG + Intergenic
1086491260 11:87359870-87359892 GGAGTCGGTGGGGGAGTAGCTGG - Intergenic
1089602205 11:119623134-119623156 GGAGGTGATTTGGGGGTGGCTGG + Intergenic
1089603794 11:119630071-119630093 GGAGAGGGAATGGGAGTGGCTGG + Intronic
1091256052 11:134187076-134187098 GGAGGCTGGCTGGGAGTGGAGGG - Intronic
1091419538 12:324369-324391 GGAGGCATTTTGGGGGTGGCCGG + Intronic
1092471519 12:8786094-8786116 GGACGAGATTTGGGAGGGGCTGG - Intergenic
1092797630 12:12128912-12128934 GGAGGAGGAGTGGGGGTGGCAGG - Intronic
1093597140 12:20975743-20975765 GGAGCCTGTTGGGGAGTGGGGGG - Intergenic
1094448407 12:30558598-30558620 GGTGGCGGGTTGGGAGTGGCGGG + Intergenic
1094493692 12:30976686-30976708 GGAGGAGGTCAGGAAGTGGCGGG - Intronic
1097165894 12:57086655-57086677 GGAGGGGAGTTGGGGGTGGCAGG + Intronic
1097192338 12:57225469-57225491 GGGGGCGCGTTGGGAGTGCCTGG + Exonic
1097289505 12:57902547-57902569 GGAGGCTTTGTGGAAGTGGCAGG + Intergenic
1098426013 12:70366377-70366399 GGAGGCGGGGTGGGGGAGGCGGG + Exonic
1103907156 12:124333665-124333687 GGAGGCGTTTTGGTGGGGGCGGG - Intronic
1103976828 12:124708060-124708082 GGAGGAGGGCTGGGAGTGGATGG - Intergenic
1104581419 12:130013916-130013938 GGACGGGGGCTGGGAGTGGCAGG + Intergenic
1105257504 13:18753864-18753886 GGAGGTGGGTTGGGGGTGGAAGG - Intergenic
1106451684 13:29888109-29888131 GGAGGCTGTTTTGGAGGAGCAGG - Intergenic
1107881582 13:44836838-44836860 GGAGGCTGGTCCGGAGTGGCTGG - Intergenic
1108206453 13:48095014-48095036 GGAGGCGGTTTGGGAGTGGCGGG - Exonic
1108738112 13:53306712-53306734 GGAGGCCGTTTATGTGTGGCTGG - Intergenic
1109619252 13:64880124-64880146 GCAGGGGGTTTGGGGGAGGCGGG - Intergenic
1111227567 13:85294453-85294475 GGAGTCAGTGTGTGAGTGGCAGG + Intergenic
1111951799 13:94713589-94713611 GGAGGAGGATTGGGAGGGGGCGG - Intergenic
1112059964 13:95729239-95729261 GGAGGCGGAGAGGGAGTGGGAGG - Intronic
1113610013 13:111637926-111637948 GGAGGGGGTTTGGGTGGGGAGGG + Intronic
1113887621 13:113669289-113669311 TGAGGGGGTTTGGGAGGTGCTGG + Intronic
1115447316 14:33506077-33506099 GGAGGAGGATAGGGAGTGGCAGG - Intronic
1116991687 14:51284088-51284110 TGAGGAGGTTTGGGAGTGGTTGG + Intergenic
1117086170 14:52203629-52203651 GGAGGCAGTTGGGGAGAGTCAGG - Intergenic
1118709319 14:68506717-68506739 GGAGAAGGTTTGGGAATGGCTGG + Intronic
1119068492 14:71555798-71555820 GGAGGCAGATGGGGAATGGCTGG + Intronic
1119621629 14:76136053-76136075 GGAGGCGGTTGGGGATTGAGAGG - Intergenic
1120706161 14:87747992-87748014 GGAGTCGGTGGGCGAGTGGCAGG + Intergenic
1122301957 14:100736655-100736677 GGAGGCGGTGAGGGTGGGGCGGG - Exonic
1122937259 14:104966003-104966025 TGAAGCGGTGAGGGAGTGGCAGG - Intronic
1122978027 14:105178988-105179010 GGTGGTGGTTCGGGGGTGGCTGG - Intronic
1123033241 14:105460966-105460988 GGTGGCGATGGGGGAGTGGCTGG + Intronic
1124363290 15:29054289-29054311 GGAGGCGGTGGAGGAGTGGACGG + Exonic
1125929497 15:43590136-43590158 GGGGGCGGTGGGGGAGTGGCTGG - Intronic
1125942664 15:43689968-43689990 GGGGGCGGTGGGGGAGTGGCTGG - Intergenic
1128227339 15:66011256-66011278 GAAGGTGGTATGGGAGTGGGAGG + Intronic
1128335042 15:66780363-66780385 GGAGGCGGGCTGGGGGTGGGAGG - Intronic
1128366925 15:67011006-67011028 GGGGGTGATTTGGTAGTGGCAGG - Intergenic
1128509372 15:68303935-68303957 GGTGGCAGTCTGGGAGGGGCAGG + Intronic
1128781195 15:70359815-70359837 GGAGGTGGTGTGGGCCTGGCTGG + Intergenic
1129185904 15:73906303-73906325 GGAGGAGGTCGGGGAGAGGCTGG + Intergenic
1129334505 15:74844080-74844102 GGATGCGGTTCTGGACTGGCTGG + Exonic
1129913956 15:79251604-79251626 GGAGGGTGTTTGGGGGTGGAGGG - Intergenic
1130389954 15:83446906-83446928 GGAAGCGGTCTGTGGGTGGCGGG - Intergenic
1131898596 15:97062262-97062284 GGAGGTGGTTTAGGTGTGGAGGG - Intergenic
1134512620 16:14860527-14860549 GGAGGAGATATGGTAGTGGCCGG + Intronic
1134615705 16:15650037-15650059 GGAGGGGGTTTGAGAGGCGCCGG - Intronic
1134700257 16:16259022-16259044 GGAGGAGATATGGTAGTGGCTGG + Intronic
1134971569 16:18535637-18535659 GGAGGAGATATGGTAGTGGCCGG - Intronic
1135755253 16:25091932-25091954 GCAGGTGGTGTGGGAGTGGCTGG - Intergenic
1135830169 16:25765863-25765885 GGAGGGGGTTTGGATGTGGTTGG + Intronic
1136409412 16:30067395-30067417 GGTGCAGGGTTGGGAGTGGCAGG + Intronic
1136499452 16:30662747-30662769 GGTGGCAGACTGGGAGTGGCCGG - Exonic
1136506866 16:30710037-30710059 TGAGGGGGTTTGAGAGGGGCTGG - Exonic
1136621751 16:31434016-31434038 GGTGGAGGGGTGGGAGTGGCAGG + Intronic
1136705888 16:32187953-32187975 GGAGGCGGTGCGGGGTTGGCGGG - Intergenic
1136762024 16:32741452-32741474 GGAGGCGGTGCGGGGTTGGCGGG + Intergenic
1136772383 16:32852513-32852535 GGAGACTGTTGGGGAGTGGGGGG + Intergenic
1136806076 16:33128936-33128958 GGAGGCGGTGCGGGGTTGGCGGG - Intergenic
1136913023 16:34159631-34159653 GGAGGCGGTGGGGGAGCCGCGGG + Intergenic
1138889844 16:61128838-61128860 GGAGCCGGTGGGGGAGGGGCGGG + Intergenic
1139381989 16:66538361-66538383 AGAGGGGGTTTGAGAGGGGCAGG - Intronic
1139493481 16:67299780-67299802 GGAGGTGAGTTGGGAGTGGGGGG + Intronic
1139949133 16:70660767-70660789 GGATGCGGATTTGGAGTGGATGG + Intergenic
1141524670 16:84603963-84603985 GGAGGTGGGTGGGGAGTGGCGGG - Intronic
1141862565 16:86728022-86728044 GGAGGGGGTGTGGGAGAGGAAGG + Intergenic
1142278651 16:89136640-89136662 GGAGGCCGTTGGGGAGCTGCAGG - Intronic
1203064183 16_KI270728v1_random:1001768-1001790 GGAGGCGGTGCGGGGTTGGCGGG + Intergenic
1203074806 16_KI270728v1_random:1114611-1114633 GGAGACTGTTGGGGAGTGGGGGG + Intergenic
1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG + Exonic
1142716129 17:1747918-1747940 GGAGGCTGTCTGGGTGTGGTGGG + Intronic
1143297749 17:5883866-5883888 GGAGGCGGGTTGGGGGAGGGGGG - Intronic
1144664213 17:17091086-17091108 GGGGGCGGTTGGGGAGGGGGTGG + Intronic
1144724959 17:17497058-17497080 GCAGGCGGGTGGGGAGCGGCAGG + Intergenic
1145012072 17:19374226-19374248 GGAGGCTGTCAGGGAGTGGCAGG + Intronic
1147314927 17:39615495-39615517 GGAGTGGGTTTGGGAGGGGCTGG - Intergenic
1148709177 17:49664641-49664663 AGAGCAGTTTTGGGAGTGGCTGG - Intronic
1148956220 17:51355773-51355795 GGAGGCAGTATGGGAGCGGGAGG - Intergenic
1149993543 17:61395826-61395848 GGCGGCGGTGGGGGAGTGGGGGG - Intergenic
1150358100 17:64505710-64505732 GGAGGTGTTTTTGGGGTGGCCGG - Intronic
1152499026 17:80695812-80695834 GGAGGAGCGTTGGGGGTGGCTGG + Intronic
1152637622 17:81436576-81436598 GGCGGGGGTAGGGGAGTGGCAGG - Intronic
1158400986 18:57121722-57121744 GGCGGCGGTTAGGGCGTGGAAGG - Intergenic
1160787755 19:909174-909196 GGAGTAGAATTGGGAGTGGCCGG - Intronic
1161079890 19:2305508-2305530 GGAGGCGGATTGGAAGGGCCGGG - Intronic
1161164536 19:2779097-2779119 GGGGGCGGTTTGGCAGTGTCTGG - Intronic
1161352820 19:3803397-3803419 GGCGGCGGGACGGGAGTGGCAGG - Intergenic
1161379803 19:3958958-3958980 GGAGGCGGAGTGGGAGGAGCTGG - Exonic
1161487328 19:4543380-4543402 TGAGACGGTTTGGGGGTGGGTGG - Exonic
1161995063 19:7706962-7706984 GGAAGAGGTATGGGCGTGGCTGG - Intergenic
1162000677 19:7743046-7743068 GGAGGGGGGTTTGGGGTGGCAGG + Exonic
1162648134 19:12064926-12064948 GGAGGCTGGTTGGAACTGGCTGG + Intronic
1162947905 19:14054783-14054805 GGAGGTGGTCTGGGAGGGGGTGG - Exonic
1163130136 19:15267330-15267352 GGTGGGGGGCTGGGAGTGGCAGG - Intronic
1163325295 19:16599707-16599729 GGGAGCGGTTTGGCAGGGGCTGG - Intronic
1163653897 19:18534394-18534416 GAGAGCAGTTTGGGAGTGGCTGG - Intronic
1166303455 19:41924699-41924721 GGAGCAGGTGTGGGGGTGGCTGG + Intronic
1166367044 19:42283153-42283175 GGAGGCGCTTTGTGAGTGCTAGG + Intronic
1167461255 19:49625772-49625794 GGAGGGGGCTTGGGAGAGGGGGG - Exonic
925928063 2:8685002-8685024 GGAGGTGGGTGGGGTGTGGCGGG - Intergenic
926297026 2:11576553-11576575 GGAGGAGGTATGGGAGTGCTGGG + Intronic
927054938 2:19358817-19358839 GGACGCAGGTTGGGAGAGGCCGG - Intergenic
929870707 2:45756811-45756833 GGAGGTTGTGTGGGAGGGGCAGG + Intronic
931277493 2:60756509-60756531 GGCGGCGGTTGGGGTGAGGCGGG + Intronic
931376693 2:61714227-61714249 GGAGGTCGTTGGGGAGTGGGTGG + Intergenic
931601440 2:64007301-64007323 GGAGGTGGTAGGGGAGTGACTGG + Intronic
931696725 2:64876490-64876512 GGAGGAGGCTGGGGAGTGGCAGG - Intergenic
932845272 2:75128606-75128628 GGACTGGGGTTGGGAGTGGCTGG + Intronic
933624825 2:84586356-84586378 GCAGGCGTGTTGGCAGTGGCAGG + Intronic
934039475 2:88116008-88116030 GGAGGCGGTTCAGGAGAGGCTGG + Intergenic
936080420 2:109429112-109429134 GGAGGCAGGTTGGGAAGGGCCGG + Intronic
937691140 2:124756762-124756784 GTAGGAGGGTTGGGAGTGGGAGG + Intronic
937727979 2:125189546-125189568 GGAGGACGTTTGGGAGAAGCGGG + Intergenic
938657819 2:133452548-133452570 GGAGGCAGTAGGGGAGAGGCAGG + Intronic
938806941 2:134814813-134814835 GTTGGCTGTTTGGCAGTGGCAGG - Intergenic
939628317 2:144505603-144505625 GGAGGTGGGCTGGGAGTGGGGGG + Intronic
940714512 2:157204903-157204925 GGAAGGGCTTTTGGAGTGGCTGG - Intergenic
942278493 2:174340204-174340226 AGAGGCGCTTAGGGAGTGGGGGG - Intergenic
943821187 2:192323654-192323676 GGATGGGGTTGGGGAGTGGCGGG + Intergenic
945416042 2:209574198-209574220 GGGGACAGTTTGGCAGTGGCAGG - Intronic
947432525 2:230043552-230043574 GGAGGGTGCTTGGGGGTGGCTGG + Intronic
947931413 2:233968213-233968235 GGAGGGGGTGCGGGGGTGGCGGG - Intronic
949032104 2:241802155-241802177 GAAGGCGGGTTGGGAGGGCCTGG + Intronic
1168771784 20:420638-420660 GCAGGCAGGTTGGGAGGGGCGGG - Intronic
1169474323 20:5917259-5917281 GGAGGGGGTTTGGGAAATGCTGG + Intronic
1170408973 20:16067899-16067921 GGAAGGTGTTTGGGAGTGGAGGG - Intergenic
1170929094 20:20752685-20752707 GGAGGTGGTTTGGGTGGGGAAGG - Intergenic
1171255967 20:23689203-23689225 GGAGGAGGCCTGGGAGGGGCAGG - Intergenic
1171263315 20:23751100-23751122 GGAGGAGGCCTGGGAGGGGCAGG - Intronic
1171272372 20:23826894-23826916 GGAGGAGGCCTGGGAGGGGCAGG - Intergenic
1171532945 20:25864069-25864091 GGAGGCGGCTTGTGACTGACCGG + Intronic
1172468617 20:35175037-35175059 GGAGGCGGGCTGGGACTTGCAGG + Intronic
1172614508 20:36274512-36274534 TGGGGCTGTTTGGGAGCGGCTGG + Intergenic
1173554101 20:43953451-43953473 GCATGCGGGTTGGGAGTGGAAGG - Intronic
1174003220 20:47389961-47389983 GGGGGTGGTGTGGGCGTGGCAGG - Intergenic
1174364114 20:50046113-50046135 GGAGGTGGTTTGGGAGGGACAGG - Intergenic
1175332043 20:58171899-58171921 GGAGTCGGTGTGGGGGTGGATGG - Intergenic
1175501980 20:59456939-59456961 GGAGCCGGGCTGGGAGTGGCCGG - Intergenic
1175822193 20:61916188-61916210 GGGAGGGGTTGGGGAGTGGCGGG + Intronic
1175878749 20:62244222-62244244 GGACGCGGTGAGGGAGTGGGAGG - Intronic
1175980554 20:62736482-62736504 AGAGGGGGTTTGGGAGAGGAGGG + Intronic
1176039385 20:63056331-63056353 GGAAGGGGTGTGGGAGCGGCCGG - Intergenic
1176689290 21:9883640-9883662 GAAGGCAGTTGGGTAGTGGCTGG + Intergenic
1177444800 21:21179982-21180004 GGAGGCCATTTGGGACTGTCTGG - Intronic
1177659036 21:24058310-24058332 GGAGGTGGTTGGGAAGTGGATGG - Intergenic
1177792548 21:25735739-25735761 GGAGCCGGGTGGGGAGGGGCGGG + Intronic
1178919893 21:36731788-36731810 GGAGGCGGTTTGGGAACATCAGG + Intronic
1179790583 21:43753887-43753909 GGAGGCGATGTGAGAGTGACAGG - Intronic
1180066788 21:45416346-45416368 GGGGCCGGTGTGGGGGTGGCCGG + Intronic
1180970401 22:19812041-19812063 GGAGGCGTTGGGGGAGGGGCCGG - Intronic
1181049923 22:20233623-20233645 GGTGGTGTTGTGGGAGTGGCTGG + Intergenic
1181113083 22:20613179-20613201 GGAGGAGGTGGGGGAGTGGGGGG + Intergenic
1182296029 22:29311625-29311647 GGAGGCCGTCTCGGAGAGGCCGG - Intronic
1183221401 22:36515897-36515919 GGGGGCGGATTGGGAGGGGTGGG + Intronic
1183246204 22:36695478-36695500 GGTGGGGGTGGGGGAGTGGCAGG - Intronic
1183648535 22:39140688-39140710 GCAGGCGGGCTGGGAGAGGCAGG + Intronic
1184412022 22:44331300-44331322 GTGGGCGCTTTGGGAGAGGCGGG - Intergenic
1184725114 22:46340041-46340063 GGAGGGAGTGTGGGAGTGGAAGG + Intronic
1185138406 22:49086847-49086869 GGAGGCCGTCGGGGAGAGGCCGG + Intergenic
1185397851 22:50601543-50601565 GGAGGCGGGGTGGGAGGGGTGGG + Intronic
951335866 3:21421040-21421062 GGGGGAGGTTTGGGGGTGGGAGG - Exonic
951432361 3:22622911-22622933 GGGGCCTGTTTGGGGGTGGCAGG - Intergenic
953884078 3:46705802-46705824 GGAGGCGGCTTGGGCTTGGGTGG - Exonic
953960356 3:47261568-47261590 GGAAGCAGTCTAGGAGTGGCTGG + Intronic
955971776 3:64444651-64444673 GGAGGTGGGGTGGGAGGGGCAGG - Intronic
956604892 3:71064619-71064641 GGAGGCGGGGAGGGAGTGGAGGG - Intronic
957041671 3:75340744-75340766 GGAGGGGGCTGTGGAGTGGCTGG + Intergenic
959940421 3:112075376-112075398 GGAGGGGGGTTGGCCGTGGCAGG + Exonic
960331850 3:116369696-116369718 GGGGGAGGTTTGGGAGGGGAGGG - Intronic
961523869 3:127484253-127484275 GGGAGCGGTTTGGGGGTCGCAGG - Intergenic
963503951 3:146161439-146161461 GGAGTGGGTTTGGGAGAGGGAGG + Intronic
965559436 3:170047235-170047257 GGATGCGGTGAGGGTGTGGCAGG - Intronic
967138549 3:186533051-186533073 GGAGGAGGTTGGGGAGGGGAGGG - Intergenic
967151041 3:186651360-186651382 GGAGGGGGTAAGGTAGTGGCAGG - Intronic
967193535 3:187006034-187006056 GAGGGCTGTTGGGGAGTGGCAGG + Intronic
967876468 3:194271294-194271316 GGAGGCGGGTGGCGGGTGGCAGG - Intergenic
967903853 3:194485906-194485928 GGAATCGGGTTGGGATTGGCAGG - Intronic
968662391 4:1804104-1804126 GGTGGCGGTGTGGGACTGGCTGG + Intronic
972373939 4:38452738-38452760 TGGGCCGGTCTGGGAGTGGCTGG + Intergenic
973847953 4:54932292-54932314 GGAGAAGGTTTGAGACTGGCAGG - Intergenic
973863370 4:55087530-55087552 GGAGGGGGATTGGAAGTGGAAGG - Intronic
975452355 4:74544119-74544141 AGAGGAGGTTTGTGAGTGGTAGG + Intergenic
980352676 4:131701455-131701477 GAAGGCAGTTGGGTAGTGGCTGG + Intergenic
982832830 4:160085673-160085695 ACAGGAGATTTGGGAGTGGCCGG - Intergenic
984705484 4:182844602-182844624 GGAGGGGATTTTGGATTGGCTGG - Intergenic
985268252 4:188170252-188170274 GGGGGGGGGTTGGGAGTGGTGGG + Intergenic
986050448 5:4084992-4085014 GAAGCGGGCTTGGGAGTGGCGGG + Intergenic
988829123 5:34970624-34970646 GGAGGGGGCTTTGGAGTGGGGGG + Intergenic
989538984 5:42596981-42597003 GGAGGATGTTTAGGAATGGCTGG + Intronic
994631072 5:102288636-102288658 GGAGGCTGTTTTGGAGAGGCAGG - Intronic
995104976 5:108366570-108366592 GGAGGGGGTTTGGGTGGGGGAGG + Intronic
995854353 5:116576356-116576378 GGAGGGGGTTGGGGAGTGTGGGG + Intergenic
997089559 5:130841391-130841413 GGAGCCTGTTGGGGAGTGGGGGG - Intergenic
997999249 5:138610968-138610990 GGAGGGGGTTGGGCAGTCGCTGG + Intronic
1000798763 5:165697781-165697803 GTAGGAGGTTTGGGGGTGGGAGG + Intergenic
1003002310 6:2347709-2347731 GGAGGCGGTGTGGGTGTGGAAGG - Intergenic
1003666061 6:8112486-8112508 GAAGGGGGTTTGGGGGGGGCTGG - Intergenic
1004425284 6:15502813-15502835 GGATGCGGTGTGGGGGTTGCTGG + Intronic
1004757204 6:18624215-18624237 GGAAGAGGTTGGGGAGTTGCAGG + Intergenic
1004943852 6:20590509-20590531 GGGGGCTGTTGGGGAGTGGGGGG - Intronic
1005778125 6:29160041-29160063 GGAGGCCGTTAGGGTGTGGAGGG + Intergenic
1005778736 6:29165838-29165860 GGAGGCCGTTAGGGTGTGGAGGG - Intergenic
1006434099 6:34017276-34017298 GGGGGCGGCTTGGGCATGGCGGG + Intergenic
1007726332 6:43918075-43918097 GCAGGCTGTTTGGCAGTAGCAGG + Intergenic
1008092870 6:47309853-47309875 GGAGGGTGGTTGGCAGTGGCTGG - Exonic
1012448661 6:99332044-99332066 GGAGGGGGCTGGGGAGAGGCTGG - Intronic
1014948024 6:127519048-127519070 GGACGGGGGTGGGGAGTGGCGGG + Exonic
1015693978 6:135958519-135958541 TGAGGTGGTTTGAGATTGGCAGG - Intronic
1018850033 6:167580697-167580719 GGAGGCTGTCTGGGTGTGTCTGG - Intergenic
1019407154 7:889735-889757 GGACGGGGTCTGGGAGTGGAGGG + Intronic
1019407177 7:889815-889837 GGACGGGGTCTGGGAGTGGAGGG + Intronic
1019407188 7:889855-889877 GGACGGGGTCTGGGAGTGGAGGG + Intronic
1019407199 7:889895-889917 GGACGGGGTCTGGGAGTGGAGGG + Intronic
1019407210 7:889935-889957 GGACGGGGTCTGGGAGTGGAGGG + Intronic
1019407221 7:889975-889997 GGACGGGGTCTGGGAGTGGAGGG + Intronic
1019407232 7:890015-890037 GGACGGGGTCTGGGAGTGGAGGG + Intronic
1019407243 7:890055-890077 GGACGGGGTCTGGGAGTGGAGGG + Intronic
1019407284 7:890212-890234 GGACGGGGTCTGGGAGTGGAGGG + Intronic
1019407295 7:890252-890274 GGACGGGGTCTGGGAGTGGAGGG + Intronic
1019407306 7:890292-890314 GGACGGGGTCTGGGAGTGGAGGG + Intronic
1019407317 7:890332-890354 GGACGGGGTCTGGGAGTGGAGGG + Intronic
1019407328 7:890372-890394 GGACGGGGTCTGGGAGTGGAGGG + Intronic
1019421162 7:952019-952041 GGAGGGGGTTTGGGGGAGGGAGG - Intronic
1019479358 7:1259560-1259582 GGGGGCTGTTAGGGAGGGGCGGG + Intergenic
1019921961 7:4168901-4168923 GGTGGTGGGGTGGGAGTGGCTGG - Intronic
1019990812 7:4689352-4689374 AGAGGCGTATTGTGAGTGGCAGG + Intronic
1020256204 7:6504185-6504207 GGCGGGGCTTTGGGATTGGCCGG + Intronic
1021510409 7:21427662-21427684 GGAGGGGGTTTTTGAGTGGAGGG + Intergenic
1022550221 7:31231581-31231603 GGAGGGGGTTTGGGGGTGGAGGG + Intergenic
1023791701 7:43758390-43758412 GGAGGGCGTATGGAAGTGGCTGG - Intergenic
1024054287 7:45649695-45649717 GGAGGCGGTTGGGAGGAGGCTGG + Intronic
1026359515 7:69590855-69590877 GGAGGCGGTAAGGGAGTGGAAGG + Intergenic
1026577004 7:71580769-71580791 GGAGGAGGTTTGGGAGAAGGTGG + Intronic
1029439081 7:100577438-100577460 GGAGGCGGTTGGGGGGTGGGAGG + Intronic
1030197162 7:106863756-106863778 GGAGGAGGTTTGAGGGTGGGAGG - Intergenic
1031427293 7:121621192-121621214 GGTGGGGGTTGGGGGGTGGCGGG + Intergenic
1031557655 7:123198290-123198312 GGAGCCGGGGTGGGAGTGGCAGG + Intronic
1032054822 7:128675755-128675777 GGAGGACATTGGGGAGTGGCAGG - Exonic
1032095860 7:128938278-128938300 GGAGGCGCTTTGGAAGTCCCAGG - Intronic
1033705481 7:143882132-143882154 GGAGGGGGCTGGGGAGTGGGGGG + Intronic
1034459429 7:151190342-151190364 AGAGGTGCTTGGGGAGTGGCGGG - Intergenic
1035085334 7:156253227-156253249 GCAGGCAGTTTGGCAGTGTCTGG + Intergenic
1035357281 7:158283778-158283800 GGAGGCCATTAGGGAGGGGCTGG - Intronic
1035840609 8:2809042-2809064 GGAGGCTGGTTGGTAGTTGCAGG - Intergenic
1037067890 8:14605533-14605555 GGAGGGGCTTGGGGAGTGGGTGG - Intronic
1037449007 8:18997852-18997874 GGAGGGAGTTTGGGAGGGGGTGG - Intronic
1037593063 8:20329521-20329543 GGAGGAGGGTTGGGAGCGGCGGG + Intergenic
1037691435 8:21184569-21184591 CGCGGGGGGTTGGGAGTGGCTGG - Intergenic
1037747587 8:21659250-21659272 GGAGAAGGATTGGGAGTGCCAGG - Intergenic
1037883930 8:22586437-22586459 GGAGGCGTTCTGGGAGGGGAGGG + Intronic
1041919902 8:63169187-63169209 GGAGACGGATTCCGAGTGGCGGG + Intronic
1042307728 8:67348858-67348880 GGTGGGGGTGTGGGAGTGGGCGG + Intergenic
1042670533 8:71258136-71258158 GGAGGCTGTTTGGTAGGGGATGG - Intronic
1043833302 8:85016114-85016136 AGAGGTGGCTTTGGAGTGGCTGG - Intergenic
1044739174 8:95308137-95308159 GGAGGAGATTTGGCTGTGGCAGG + Intergenic
1044846276 8:96385084-96385106 GGAGGAAGTTAGGGAGGGGCTGG - Intergenic
1046695060 8:117330770-117330792 GGAGGCAATTTGTGAGTGGCTGG + Intergenic
1047585588 8:126268716-126268738 GGAGGCTGGCTGGGAGAGGCTGG - Intergenic
1049226303 8:141452114-141452136 GGAGGCTGAGCGGGAGTGGCCGG + Intergenic
1049258381 8:141625774-141625796 GGTGGTGGGATGGGAGTGGCAGG + Intergenic
1049689572 8:143952790-143952812 GGAGCCGGCTTGGGGGAGGCGGG - Intronic
1049719154 8:144107641-144107663 GCCTGCGGTGTGGGAGTGGCCGG + Intronic
1049728610 8:144163855-144163877 GCATGGGGATTGGGAGTGGCCGG + Intronic
1050304918 9:4297996-4298018 GGAGGCGGCGGGGGAGTGACGGG - Intronic
1052975513 9:34407122-34407144 GGAGGGTGTTTGGGAGGGGATGG - Intronic
1053284593 9:36842049-36842071 GGAGGCAGTATGGCAGTGGAGGG + Intronic
1053780037 9:41598256-41598278 GAAGGCAGTTGGGTAGTGGCTGG - Intergenic
1054167994 9:61808499-61808521 GAAGGCAGTTGGGTAGTGGCTGG - Intergenic
1054669552 9:67772405-67772427 GAAGGCAGTTGGGTAGTGGCTGG + Intergenic
1054745711 9:68852334-68852356 GGGGGCGGTGTGGGGGAGGCGGG - Intronic
1055875191 9:80933673-80933695 GGAGATGCTTTGGGAGTGTCAGG + Intergenic
1056914941 9:90738258-90738280 GGATGAGATTTGGGAGGGGCTGG + Intergenic
1057907124 9:98992093-98992115 GGAGGCAGCGTGGGACTGGCAGG - Intronic
1058499503 9:105596769-105596791 GGTGGCCGGTTGGTAGTGGCAGG + Intronic
1060325436 9:122610011-122610033 TGAGGCGGATTGGGAGAGCCAGG + Intergenic
1061302671 9:129714610-129714632 GGGGGCGGTCTGGGGCTGGCTGG + Intronic
1061491693 9:130948350-130948372 GGAGGTGCTGAGGGAGTGGCAGG + Intergenic
1061789175 9:133049848-133049870 GGAGGCTGAGTGGGGGTGGCTGG - Intronic
1061892641 9:133630866-133630888 GGAGGTGGTCTTGGATTGGCTGG - Intergenic
1062022483 9:134326129-134326151 GGAGGCGGCGTGGGAGGGGGCGG - Intronic
1062103796 9:134741823-134741845 GGCGGGAGGTTGGGAGTGGCAGG - Intronic
1062596028 9:137299981-137300003 GGAGGCCCTTTGTGCGTGGCTGG - Intergenic
1062619176 9:137411734-137411756 GGAGGGGGTGGGGGAGTGGGAGG + Intronic
1203568325 Un_KI270744v1:109910-109932 GGGGGCGGTTGGAGAGTAGCTGG + Intergenic
1186917933 X:14244043-14244065 GGAGGGGGTTGGGCAGTGCCTGG - Intergenic
1186932938 X:14414516-14414538 GAATGGGGGTTGGGAGTGGCAGG + Intergenic
1190330619 X:49233131-49233153 AGAGGCTGTTTGGGGCTGGCTGG + Intronic
1193397575 X:81003809-81003831 GGAGGCTGTTAGGGCGTGGAGGG - Intergenic
1193416081 X:81226058-81226080 GGAGGTGGTTGGGGAGTTGTTGG - Intronic
1197776008 X:130119208-130119230 GGAGGGGGTGGGGGAGTGGGAGG - Intergenic
1198051336 X:132956027-132956049 CGTGGCTCTTTGGGAGTGGCGGG - Intronic
1199203743 X:145123839-145123861 GCATGAGATTTGGGAGTGGCCGG - Intergenic
1200123033 X:153800201-153800223 GGAGGGGGGTTGGGAGGGGCCGG + Intergenic