ID: 1108207403

View in Genome Browser
Species Human (GRCh38)
Location 13:48104636-48104658
Sequence CAGAGTAAAGATGATGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108207400_1108207403 -2 Left 1108207400 13:48104615-48104637 CCTTCATAAAATGTGACAACCCA No data
Right 1108207403 13:48104636-48104658 CAGAGTAAAGATGATGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108207403 Original CRISPR CAGAGTAAAGATGATGTTGC AGG Intergenic
No off target data available for this crispr