ID: 1108212455

View in Genome Browser
Species Human (GRCh38)
Location 13:48152063-48152085
Sequence AATGGAAAACAGGAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1108212446_1108212455 27 Left 1108212446 13:48152013-48152035 CCTGCAGCATGGAATGGCCAGCA No data
Right 1108212455 13:48152063-48152085 AATGGAAAACAGGAGGAGGAGGG No data
1108212447_1108212455 10 Left 1108212447 13:48152030-48152052 CCAGCATGTGAATTCAATGTGAA No data
Right 1108212455 13:48152063-48152085 AATGGAAAACAGGAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1108212455 Original CRISPR AATGGAAAACAGGAGGAGGA GGG Intergenic
No off target data available for this crispr